RNF146 (NM_001242849) Human Untagged Clone

CAT#: SC331902

RNF146 (untagged) - Homo sapiens ring finger protein 146 (RNF146), transcript variant 8



  "NM_001242849" in other vectors (2)

CNY 3,420.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RNF146 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC331902 representing NM_001242849.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATGGCTGGCTGTGGTGAAATTGATCATTCAATAAACATGCTTCCTACAAACAGGAAAGCGAACGAG
TCCTGTTCTAATACTGCACCTTCTTTAACCGTCCCTGAATGTGCCATTTGTCTGCAAACATGTGTTCAT
CCAGTCAGTCTGCCCTGTAAGCACGTTTTCTGCTATCTATGTGTAAAAGGAGCTTCATGGCTTGGAAAG
CGGTGTGCTCTTTGTCGACAAGAAATTCCCGAGGATTTCCTTGACAAGCCAACCTTGTTGTCACCAGAA
GAACTCAAGGCAGCAAGTAGAGGAAATGGTGAATATGCATGGTATTATGAAGGAAGAAATGGGTGGTGG
CAGTACGATGAGCGCACTAGTAGAGAGCTGGAAGATGCTTTTTCCAAAGGTAAAAAGAACACTGAAATG
TTAATTGCTGGCTTTCTGTATGTCGCTGATCTTGAAAACATGGTTCAATATAGGAGAAATGAACATGGA
CGTCGCAGGAAGATTAAGCGAGATATAATAGATATACCAAAGAAGGGAGTAGCTGGACTTAGGCTAGAC
TGTGATGCTAATACCGTAAACCTAGCAAGAGAGAGCTCTGCTGACGGAGCGGACAGTGTATCAGCACAG
AGTGGAGCTTCTGTTCAGCCCCTAGTGTCTTCTGTAAGGCCCCTAACATCAGTAGATGGTCAGTTAACA
AGCCCTGCAACACCATCCCCTGATGCAAGCACTTCTCTGGAAGACTCTTTTGCTCATTTACAACTCAGT
GGAGACAACACAGCTGAAAGGAGTCATAGGGGAGAAGGAGAAGAAGATCATGAATCACCATCTTCAGGC
AGGGTACCAGCACCAGACACCTCCATTGAAGAAACTGAATCAGATGCCAGTAGTGATAGTGAGGATGTA
TCTGCAGTTGTTGCACAGCACTCCTTGACCCAACAGAGACTTTTGGTTTCTAATGCAAACCAGACAGTA
CCCGATCGATCAGATCGATCGGGAACTGATCGATCAGTAGCAGGGGGTGGAACAGTGAGTGTCAGTGTC
AGATCTAGAAGGCCTGATGGACAGTGCACAGTAACTGAAGTTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001242849
Insert Size 1080 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242849.1
RefSeq Size 2433 bp
RefSeq ORF 1080 bp
Locus ID 81847
UniProt ID Q9NTX7
Protein Families Druggable Genome
MW 39 kDa
Gene Summary E3 ubiquitin-protein ligase that specifically binds poly-ADP-ribosylated (PARsylated) proteins and mediates their ubiquitination and subsequent degradation. May regulate many important biological processes, such as cell survival and DNA damage response. Acts as an activator of the Wnt signaling pathway by mediating the ubiquitination of PARsylated AXIN1 and AXIN2, 2 key components of the beta-catenin destruction complex. Acts in cooperation with tankyrase proteins (TNKS and TNKS2), which mediate PARsylation of target proteins AXIN1, AXIN2, BLZF1, CASC3, TNKS and TNKS2. Recognizes and binds tankyrase-dependent PARsylated proteins via its WWE domain and mediates their ubiquitination, leading to their degradation. Different ubiquitin linkage types have been observed: TNKS2 undergoes ubiquitination at 'Lys-48' and 'Lys-63', while AXIN1 is only ubiquitinated at 'Lys-48'. May regulate TNKS and TNKS2 subcellular location, preventing aggregation at a centrosomal location. Neuroprotective protein. Protects the brain against N-methyl-D-aspartate (NMDA) receptor-mediated glutamate excitotoxicity and ischemia, by interfering with PAR-induced cell death, called parthanatos. Prevents nuclear translocation of AIFM1 in a PAR-binding dependent manner. Does not affect PARP1 activation (By similarity). Protects against cell death induced by DNA damaging agents, such as N-methyl-N-nitro-N-nitrosoguanidine (MNNG) and rescues cells from G1 arrest. Promotes cell survival after gamma-irradiation. Facilitates DNA repair.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (8) lacks two alternate internal exons, which results in the use of an upstream start codon, compared to variant 1. The encoded isoform (b) has a longer N-terminus than isoform a. Variants 8-10 encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...