Rad9 (RAD9A) (NM_001243224) Human Untagged Clone

CAT#: SC331971

RAD9A (untagged) - Homo sapiens RAD9 homolog A (S. pombe) (RAD9A), transcript variant 2



  "NM_001243224" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-RAD9A (RAD9) mouse monoclonal antibody, clone OTI7B11 (formerly 7B11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RAD9
Vector pCMV6-Entry
Sequence Data
>SC331971 representing NM_001243224.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCAGTCTTTCCTGTCTGTCTTCCGCTCACTGGCGATGCTGGAGAAGACGGTGGAAAAATGCTGCATC
TCCCTGAATGGCCGGAGCAGCCGCCTGGTGGTCCAGCTGCATTGCAAGTTCGGGGTGCGGAAGACTCAC
AACCTGTCCTTCCAGGACTGTGAGTCCCTGCAGGCCGTCTTCGACCCAGCCTCGTGCCCCCACATGCTC
CGCGCCCCAGCACGGGTTCTGGGGGAGGCTGTTCTGCCCTTCTCTCCTGCACTGGCTGAAGTGACGCTG
GGCATTGGCCGTGGCCGCAGGGTCATCCTGCGCAGCTACCACGAGGAGGAGGCAGACAGCACTGCCAAA
GCCATGGTGACTGAGATGTGCCTTGGAGAGGAGGATTTCCAGCAGCTGCAGGCCCAGGAAGGGGTGGCC
ATCACTTTCTGCCTCAAGGAATTCCGGGGGCTCCTGAGCTTTGCAGAGTCAGCAAACTTGAATCTTAGC
ATTCATTTTGATGCTCCAGGCAGGCCCGCCATCTTCACCATCAAGGACTCTTTGCTGGACGGCCACTTT
GTCTTGGCCACACTCTCAGACACCGACTCGCACTCCCAGGACCTGGGCTCCCCAGAGCGTCACCAGCCA
GTGCCTCAGCTCCAGGCTCACAGCACACCCCACCCGGACGACTTTGCCAATGACGACATTGACTCTTAC
ATGATCGCCATGGAAACCACTATAGGCAATGAGGGCTCGCGGGTGCTGCCCTCCATTTCCCTTTCACCT
GGCCCCCAGCCCCCCAAGAGCCCCGGTCCCCACTCCGAGGAGGAAGATGAGGCTGAGCCCAGTACAGTG
CCTGGGACTCCCCCACCCAAGAAGTTCCGCTCACTGTTCTTCGGCTCCATCCTGGCCCCTGTACGCTCC
CCCCAGGGCCCCAGCCCTGTGCTGGCGGAAGACAGTGAGGGTGAAGGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243224
Insert Size 948 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243224.1
RefSeq Size 1992 bp
RefSeq ORF 948 bp
Locus ID 5883
UniProt ID Q99638
Protein Families Druggable Genome, Stem cell - Pluripotency
MW 34.2 kDa
Gene Summary This gene product is highly similar to Schizosaccharomyces pombe rad9, a cell cycle checkpoint protein required for cell cycle arrest and DNA damage repair. This protein possesses 3' to 5' exonuclease activity, which may contribute to its role in sensing and repairing DNA damage. It forms a checkpoint protein complex with RAD1 and HUS1. This complex is recruited by checkpoint protein RAD17 to the sites of DNA damage, which is thought to be important for triggering the checkpoint-signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon (with an in-frame AUG) compared to variant 1. This results in a a shorter isoform (2) with a distinct N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...