TEX264 (NM_001243726) Human Untagged Clone

CAT#: SC332018

TEX264 (untagged) - Homo sapiens testis expressed 264 (TEX264), transcript variant 4



  "NM_001243726" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-TEX264 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ZSIG11
Vector pCMV6-Entry
Sequence Data
>SC332018 representing NM_001243726.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCGGACCTGCTACTACTGGGCCTGATTGGGGGCCTGACTCTCTTACTGCTGCTGACGCTGCTGGCC
TTTGCCGGGTACTCAGGGCTACTGGCTGGGGTGGAAGTGAGTGCTGGGTCACCCCCCATCCGCAACGTC
ACTGTGGCCTACAAGTTCCACATGGGGCTCTATGGTGAGACTGGGCGGCTTTTCACTGAGAGCTGCAGC
ATCTCTCCCAAGCTCCGCTCCATCGCTGTCTACTATGACAACCCCCACATGGTGCCCCCTGATAAGTGC
CGATGTGCCGTGGGCAGCATCCTGAGTGAAGGTGAGGAATCGCCCTCCCCTGAGCTCATCGACCTCTAC
CAGAAATTTGGCTTCAAGGTGTTCTCCTTCCCGGCACCCAGCCATGTGGTGACAGCCACCTTCCCCTAC
ACCACCATTCTGTCCATCTGGCTGGCTACCCGCCGTGTCCATCCTGCCTTGGACACCTACATCAAGGAG
CGGAAGCTGTGTGCCTATCCTCGGCTGGAGATCTACCAGGAAGACCAGATCCATTTCATGTGCCCACTG
GCACGGCAGGGAGACTTCTATGTGCCTGAGATGAAGGAGACAGAGTGGAAATGGCGGGGGCTTGTGGAG
GCCATTGACACCCAGGTGGATGGCACAGGAGCTGACACAATGAGTGACACGAGTTCTGTAAGCTTGGAA
GTGAGCCCTGGCAGCCGGGAGACTTCAGCTGCCACACTGTCACCTGGGGCGAGCAGCCGTGGCTGGGAT
GACGGTGACACCCGCAGCGAGCACAGCTACAGCGAGTCAGGTGCCAGCGGCTCCTCTTTTGAGGAGCTG
GACTTGGAGGGCGAGGGGCCCTTAGGGGAGTCACGGCTGGACCCTGGGACTGAGCCCCTGGGGACTACC
AAGTGGCTCTGGGAGCCCACTGCCCCTGAGAAGGGCAAGGAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001243726
Insert Size 942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243726.1
RefSeq Size 1357 bp
RefSeq ORF 942 bp
Locus ID 51368
UniProt ID Q9Y6I9
Protein Families Secreted Protein, Transmembrane
MW 34.2 kDa
Gene Summary Major reticulophagy (also called ER-phagy) receptor that acts independently of other candidate reticulophagy receptors to remodel subdomains of the endoplasmic reticulum into autophagosomes upon nutrient stress, which then fuse with lysosomes for endoplasmic reticulum turnover (PubMed:31006538, PubMed:31006537). The ATG8-containing isolation membrane (IM) cradles a tubular segment of TEX264-positive ER near a three-way junction, allowing the formation of a synapse of 2 juxtaposed membranes with trans interaction between the TEX264 and ATG8 proteins (PubMed:31006537). Expansion of the IM would extend the capture of ER, possibly through a 'zipper-like' process involving continued trans TEX264-ATG8 interactions, until poorly understood mechanisms lead to the fission of relevant membranes and, ultimately, autophagosomal membrane closure (PubMed:31006537).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 4, 5, and 7 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...