TOB (TOB1) (NM_001243885) Human Untagged Clone

CAT#: SC332052

TOB1 (untagged) - Homo sapiens transducer of ERBB2, 1 (TOB1), transcript variant 3



  "NM_001243885" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-HER2 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APRO5; APRO6; PIG49; TOB; TROB; TROB1
Vector pCMV6-Entry
Sequence Data
>SC332052 representing NM_001243885.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCCATAAGTGACCCAGCCTCATCAGTGTCCAGCTCTCCATCGCCTCCTTTTGGTCACTCTGCTGCT
GTAAGCCCTACCTTCATGCCCCGGTCCACTCAGCCTTTAACCTTTACCACTGCCACTTTTGCTGCCACC
AAGTTCGGCTCTACCAAAATGAAGAATAGTGGCCGTAGCAACAAGGTTGCACGTACTTCTCCCATCAAC
CTCGGCTTGAATGTGAATGACCTCTTGAAGCAGAAAGCCATCTCTTCCTCAATGCACTCTCTGTATGGG
CTTGGCTTGGGTAGCCAGCAGCAGCCACAGCAACAGCAGCAGCCAGCCCAGCCGCCACCGCCACCACCA
CCACCACAGCAGCAACAACAGCAGAAAACCTCTGCTCTTTCTCCTAATGCCAAGGAATTTATTTTTCCT
AATATGCAGGGTCAAGGTAGTAGTACCAATGGAATGTTCCCAGGTGACAGCCCCCTTAACCTCAGTCCT
CTCCAGTACAGTAATGCCTTTGATGTGTTTGCAGCCTATGGAGGCCTCAATGAGAAATCTTTTGTAGAT
GGCTTGAATTTTAGCTTAAATAACATGCAGTATTCTAACCAGCAATTCCAGCCTGTTATGGCTAACTAA

Restriction Sites SgfI-MluI     
ACCN NM_001243885
Insert Size 621 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243885.1
RefSeq Size 2056 bp
RefSeq ORF 621 bp
Locus ID 10140
UniProt ID P50616
Protein Families Druggable Genome
MW 22 kDa
Gene Summary This gene encodes a member of the transducer of erbB-2 /B-cell translocation gene protein family. Members of this family are anti-proliferative factors that have the potential to regulate cell growth. The encoded protein may function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...