MRAS (NM_001252090) Human Untagged Clone

CAT#: SC332172

MRAS (untagged) - Homo sapiens muscle RAS oncogene homolog (MRAS), transcript variant 3



  "NM_001252090" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
MRAS mouse monoclonal antibody, clone OTI3C4 (formerly 3C4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms M-RAs; NS11; R-RAS3; RRAS3
Vector pCMV6-Entry
Sequence Data
>SC332172 representing NM_001252090.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAACCAGCGCCGTCCCCAGTGACAACCTCCCCACATACAAGCTGGTGGTGGTGGGGGATGGGGGT
GTGGGCAAAAGTGCCCTCACCATCCAGTTTTTCCAGAAGATCTTTGTGCCTGACTATGACCCCACCATT
GAAGACTCCTACCTGAAACATACGGAGATTGACAATCAATGGGCCATCTTGGACGTTCTGGACACAGCT
GGGCAGGAGGAATTCAGCGCCATGCGGGAGCAATACATGCGCACGGGGGATGGCTTCCTCATCGTCTAC
TCCGTCACTGACAAGGCCAGCTTTGAGCACGTGGACCGCTTCCACCAGCTTATCCTGCGCGTCAAAGAC
AGGGAGTCATTCCCGATGATCCTCGTGGCCAACAAGGTCGATTTGATGCACTTGAGGAAGATCACCAGG
GAGCAAGGAAAAGAAATGGCGACCAAACACAATATTCCGTACATAGAAACCAGTGCCAAGGACCCACCT
CTCAATGTCGACAAAGCCTTCCATGACCTCGTTAGAGTAATTAGGCAACAGATTCCGGAAAAAAGCCAG
AAGAAGAAGAAGAAAACCAAATGGCGGGGAGACCGGGCCACAGGCACCCACAAACTGCAATGTGTGATC
TTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001252090
Insert Size 627 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001252090.1
RefSeq Size 4183 bp
RefSeq ORF 627 bp
Locus ID 22808
UniProt ID O14807
Protein Families Druggable Genome
Protein Pathways MAPK signaling pathway, Regulation of actin cytoskeleton, Tight junction
MW 23.8 kDa
Gene Summary This gene encodes a member of the Ras family of small GTPases. These membrane-associated proteins function as signal transducers in multiple processes including cell growth and differentiation, and dysregulation of Ras signaling has been associated with many types of cancer. The encoded protein may play a role in the tumor necrosis factor-alpha and MAP kinase signaling pathways. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...