B7H4 (VTCN1) (NM_001253849) Human Untagged Clone

CAT#: SC332241

VTCN1 (untagged) - Homo sapiens V-set domain containing T cell activation inhibitor 1 (VTCN1), transcript variant 2



  "NM_001253849" in other vectors (2)

CNY 2,640.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
VTCN1 mouse monoclonal antibody,clone OTI9E9
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B7-H4; B7h.5; B7H4; B7S1; B7X; PRO1291; VCTN1
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001253849, the custom clone sequence may differ by one or more nucleotides


ATGTTCAGAGGCCGGACAGCAGTGTTTGCTGATCAAGTGATAGTTGGCAATGCCTCTTTGCGGCTGAAAA
ACGTGCAACTCACAGATGCTGGCACCTACAAATGTTATATCATCACTTCTAAAGGCAAGGGGAATGCTAA
CCTTGAGTATAAAACTGGAGCCTTCAGCATGCCGGAAGTGAATGTGGACTATAATGCCAGCTCAGAGACC
TTGCGGTGTGAGGCTCCCCGATGGTTCCCCCAGCCCACAGTGGTCTGGGCATCCCAAGTTGACCAGGGAG
CCAACTTCTCGGAAGTCTCCAATACCAGCTTTGAGCTGAACTCTGAGAATGTGACCATGAAGGTTGTGTC
TGTGCTCTACAATGTTACGATCAACAACACATACTCCTGTATGATTGAAAATGACATTGCCAAAGCAACA
GGGGATATCAAAGTGACAGAATCGGAGATCAAAAGGCGGAGTCACCTACAGCTGCTAAACTCAAAGGCTT
CTCTGTGTGTCTCTTCTTTCTTTGCCATCAGCTGGGCACTTCTGCCTCTCAGCCCTTACCTGATGCTAAA
ATAA


Restriction Sites SgfI-MluI     
ACCN NM_001253849
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001253849.1, NP_001240778.1
RefSeq Size 2734 bp
RefSeq ORF 564 bp
Locus ID 79679
UniProt ID Q7Z7D3
Protein Families Transmembrane
Gene Summary This gene encodes a protein belonging to the B7 costimulatory protein family. Proteins in this family are present on the surface of antigen-presenting cells and interact with ligand bound to receptors on the surface of T cells. Studies have shown that high levels of the encoded protein has been correlated with tumor progression. A pseudogene of this gene is located on chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (2) differs in the 5' UTR and coding region and uses a downstream start codon compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...