Prostaglandin dehydrogenase 1 (HPGD) (NM_001256307) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	15-PGDH; PGDH; PGDH1; PHOAR1; SDR36C1
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC332341 representing NM_001256307. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGTAAGCAAAATGGAGGTGAAGGCGGCATCATTATCAATATGTCATCTTTAGCAGGACTCATGCCC GTTGCACAGCAGCCGGTTTATTGTGCTTCAAAGCATGGCATAGTTGGATTCACACGCTCAGCAGCGTTG GCTGCTAATCTTATGAACAGTGGTGTGAGACTGAATGCCATTTGTCCAGGCTTTGTTAACACAGCCATC CTTGAATCAATTGAAAAAGAAGAAAACATGGGACAATATATAGAATATAAGGATCATATCAAGGATATG ATTAAATACTATGGAATTTTGGACCCACCATTGATTGCCAATGGATTGATAACACTCATTGAAGATGAT GCTTTAAATGGTGCTATTATGAAGATCACAACTTCTAAGGGAATTCATTTTCAAGACTATGATACAACT CCATTTCAAGCAAAAACCCAATGA
Restriction Sites	SgfI-MluI
ACCN	NM_001256307
Insert Size	438 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001256307.1
RefSeq Size	2937 bp
RefSeq ORF	438 bp
Locus ID	3248
UniProt ID	P15428
Protein Families	Druggable Genome
MW	15.7 kDa
Gene Summary	This gene encodes a member of the short-chain nonmetalloenzyme alcohol dehydrogenase protein family. The encoded enzyme is responsible for the metabolism of prostaglandins, which function in a variety of physiologic and cellular processes such as inflammation. Mutations in this gene result in primary autosomal recessive hypertrophic osteoarthropathy and cranioosteoarthropathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009] Transcript Variant: This variant (6) lacks a 5' exon compared to variant 1. This variant represents translation initiation at a downstream AUG compared to variant 1; the 5'-most initiation codon, as used in variant 1, is associated with a weak Kozak sequence and a truncated ORF that would render the transcript a candidate for nonsense-mediated decay (NMD). Leaky scanning may allow translation initiation at the downstream AUG, to encode an isoform (3) with a shorter N-terminus, compared to isoform 1. Variants 3 and 6 encode the same protein (isoform 3).

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.