REA (PHB2) (NM_001267700) Human Untagged Clone

CAT#: SC332871

PHB2 (untagged) - Homo sapiens prohibitin 2 (PHB2), transcript variant 3



  "NM_001267700" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to Prohibitin 2 (prohibitin 2)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BAP; Bap37; BCAP37; hBAP; p22; PNAS-141; REA
Vector pCMV6-Entry
Sequence Data
>SC332871 representing NM_001267700.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCCAGAACTTGAAGGACTTGGCGGGACGGCTGCCCGCCGGGCCCCGGGGCATGGGCACGGCCCTG
AAGCTGTTGCTGGGGGCCGGCGCCGTGGCCTACGGTGTGCGCGAATCTGTGTTCACCGTGGAAGGCGGG
CACAGAGCCATCTTCTTCAATCGGATCGGTGGAGTGCAGCAGGACACTATCCTGGCCGAGGGCCTTCAC
TTCAGGATCCCTTGGTTCCAGTACCCCATTATCTATGACATTCGGGCCAGACCTCGAAAAATCTCCTCC
CCTACAGGCTCCAAAGACCTACAGATGGTGAATATCTCCCTGCGAGTGTTGTCTCGACCCAATGCTCAG
GAGCTTCCTAGCATGTACCAGCGCCTAGGGCTGGACTACGAGGAACGAGTGTTGCCGTCCATTGTCAAC
GAGGTGCTCAAGAGTGTGGTGGCCAAGTTCAATGCCTCACAGCTGATCACCCAGCGGGCCCAGGTATCC
CTGTTGATCCGCCGGGAGCTGACAGAGAGGGCCAAGGACTTCAGCCTCATCCTGGATGATGTGGCCATC
ACAGAGCTGAGCTTTAGCCGAGAGTACACAGCTGCTGTAGAAGCCAAACAAGTGGCACTGAGCAAGAAC
CCTGGCTACATCAAACTTCGCAAGATTCGAGCAGCCCAGAATATCTCCAAGACGATCGCCACATCACAG
AATCGTATCTATCTCACAGCTGACAACCTTGTGCTGAACCTACAGGATGAAAGTTTCACCAGGGGAAGT
GACAGCCTCATCAAGGGTAAGAAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001267700
Insert Size 786 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001267700.1
RefSeq Size 1343 bp
RefSeq ORF 786 bp
Locus ID 11331
UniProt ID Q99623
Protein Families Druggable Genome, Transcription Factors
MW 29 kDa
Gene Summary Acts as a mediator of transcriptional repression by nuclear hormone receptors via recruitment of histone deacetylases (By similarity). Functions as an estrogen receptor (ER)-selective coregulator that potentiates the inhibitory activities of antiestrogens and represses the activity of estrogens. Competes with NCOA1 for modulation of ER transcriptional activity. In mitochondria, regulates cytochrome-c oxidase assembly (COX) and mitochondrial respiration. Binding to sphingoid 1-phosphate (SPP) modulates its regulator activity (PubMed:20959514).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...