HSD11B1L (NM_001267869) Human Untagged Clone
CAT#: SC332888
HSD11B1L (untagged) - Homo sapiens hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant j
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 11-beta-HSD3; 11-DH3; HSD1L; HSD3; SCDR10; SCDR10B; SDR26C2 |
Vector | pCMV6-Entry |
Sequence Data |
>SC332888 representing NM_001267869.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCAGGTAAACTTTGTGAGCTACGTGCAACTGACGTCGCGGGCGCTGCCCAGCCTGACGGACAGCAAG GGCTCCCTGGTGGTGGTGTCCTCGCTGCTCGGCCGCGTGCCCACGTCGTTCTCCACTCCCTACTCGGCG GCCAAGTTTGCGCTGGACGGCTTCTTCGGCTCCCTGCGGCGGGAGCTGGACGTGCAGGACGTGAACGTG GCCATCACCATGTGCGTCCTGGGCCTCCGAGATCGCGCCTCCGCCGCCGAGGCAGTCAGGGGAGTCACG AGGGTCAAGGCGGCCCCGGGGCCCAAGGCAGCCCTGGCCGTGATCCGCGGCGGCGCCACGCGCGCGGCC GGCGTCTTCTACCCGTGGCGTTTCCGCCTGCTGTGCTTGCTCCGGCGCTGGCTACCGCGCCCGCGGGCC TGGTTTATCCGCCAGGAGCTCAACGTCACGGCCGCGGCAGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001267869 |
Insert Size | 459 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001267869.1 |
RefSeq Size | 1785 bp |
RefSeq ORF | 459 bp |
Locus ID | 374875 |
UniProt ID | Q7Z5J1 |
Protein Families | Druggable Genome |
MW | 16.5 kDa |
Gene Summary | This gene is a member of the hydroxysteroid dehydrogenase family. The encoded protein is similar to an enzyme that catalyzes the interconversion of inactive to active glucocorticoids (e.g. cortisone). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012] Transcript Variant: This variant (j) has multiple differences in the coding region, and initiates translation at an alternate downstream in-frame start codon, compared to variant g. The encoded isoform (d) is shorter than isoform g. Variants d and j encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233319 | HSD11B1L (Myc-DDK tagged) - Homo sapiens hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant j |
CNY 1,200.00 |
|
RG233319 | HSD11B1L (tGFP-tagged) - Homo sapiens hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant j |
CNY 4,370.00 |
其它HSD11B1L产品