KCNMA1 (NM_001271522) Human Untagged Clone
CAT#: SC333062
KCNMA1 (untagged) - Homo sapiens potassium large conductance calcium-activated channel, subfamily M, alpha member 1 (KCNMA1), transcript variant 9
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bA205K10.1; BKTM; CADEDS; hSlo; IEG16; KCa1.1; LIWAS; MaxiK; mSLO1; PNKD3; SAKCA; SLO; SLO-ALPHA; SLO1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333062 representing NM_001271522.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCAAATGGTGGCGGCGGCGGCGGCGGCAGCAGCGGCGGCGGCGGCGGCGGCGGAGGCAGCAGTCTT AGAATGAGTAGCAATATCCACGCGAACCATCTCAGCCTAGACGCGTCCTCCTCCTCCTCCTCCTCCTCT TCCTCTTCTTCTTCTTCCTCCTCCTCTTCCTCCTCGTCCTCGGTCCACGAGCCCAAGATGGATGCGCTC ATCATCCCGGTGACCATGGAGGTGCCGTGCGACAGCCGGGGCCAACGCATGTGGTGGGCTTTCCTGGCC TCCTCCATGGTGACTTTCTTCGGGGGCCTCTTCATCATCTTGCTCTGGCGGACGCTCAAGTACCTGTGG ACCGTGTGCTGCCACTGCGGGGGCAAGACGAAGGCCACCCACTTTGGGTCCCCGGAAATGCCACCAGCA GCGCGGAGCTGGAGCGGGAGTCCGCCTGAGGCCGCGGTTTTACGCGGAGCGTCTTCCCTGGCGCTCGAG GTGGCTAGATGTCGTCGGCTTTAG |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001271522 |
Insert Size | 507 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001271522.1 |
RefSeq Size | 882 bp |
RefSeq ORF | 507 bp |
Locus ID | 3778 |
UniProt ID | Q12791 |
Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
Protein Pathways | Vascular smooth muscle contraction |
MW | 17.2 kDa |
Gene Summary | MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (9) is a two-exon transcript with a distinct 3' UTR compared to variant 1. The predicted protein (short3) has a distinct C-terminus and is significantly shorter than isoform a. It is unknown if this protein is stable or has any function. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233349 | KCNMA1 (Myc-DDK tagged) - Homo sapiens potassium large conductance calcium-activated channel, subfamily M, alpha member 1 (KCNMA1), transcript variant 9 |
CNY 3,990.00 |
|
RG233349 | KCNMA1 (tGFP-tagged) - Homo sapiens potassium large conductance calcium-activated channel, subfamily M, alpha member 1 (KCNMA1), transcript variant 9 |
CNY 4,370.00 |