PX19 (PRELID1) (NM_001271828) Human Untagged Clone

CAT#: SC333126

PRELID1 (untagged) - Homo sapiens PRELI domain containing 1 (PRELID1), transcript variant 2



  "NM_001271828" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
PRELID1 mouse monoclonal antibody,clone OTI2A6
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-106; PRELI; PX19; SBBI12
Vector pCMV6-Entry
Sequence Data
>SC333126 representing NM_001271828.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGAAGTATTTCCTGGGCCAGAGCGTGCTCCGGAGTTCCTGGGACCAAGTGTTCGCCGCCTTCTGG
CAGCGGTACCCGAATCCCTATAGCAAACATGTCTTGACGGAAGACATAGTACACCGGGAGGTGACCCCT
GACCAGAAACTGCTGTCCCGGCGACTCCTGACCAAGACCAACAGGATGCCACGCTGGGCCGAGCGACTA
TTTCCTGCCAATGTTGCTCACTCGGTGTACGTCCTGGAGGACTCTATTGTGGACCCACAGAATCAGACC
ATGACTACCTTCACCTGGAACATCAACCACGCCCGGCTGATGGTGGTGGAGGAACGATGTGTTTACTGT
GTGAACTCTGACAACAGTGGCTGGACTGAAATCCGCCGGGAAGCCTGGGTCTCCTCTAGCTTATTTGGT
GTCTCCAGAGCTGTCCAGGAATTTGGTCTTGCCCGATTCAAAAGCAACGTGACCAAGACTATGAAGGGT
TTTGAATATATCTTGGCTAAGCTGCAAGCCAAGGAAGCCAAGGAGAAGGCAAAGGAGACGGCACTGGCA
GCTACAGAGAAGGCCAAGGACCTCGCCAGCAAGGCGGCCACCAAGAAGCAGCAGCAGCAGCAACAGTTT
GTGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001271828
Insert Size 627 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271828.1
RefSeq Size 1255 bp
RefSeq ORF 627 bp
Locus ID 27166
UniProt ID Q9Y255
MW 24.1 kDa
Gene Summary This gene encodes a member of the late embryogenesis abundant motif-containing protein family. The encoded protein is localized to mitochondria and may function as a cytoprotectant by regulating cell death and differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. Several related pseudogenes have been identified. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...