SHISA5 (NM_001272068) Human Untagged Clone

CAT#: SC333202

SHISA5 (untagged) - Homo sapiens shisa family member 5 (SHISA5), transcript variant 5



  "NM_001272068" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SCOTIN Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SCOTIN
Vector pCMV6-Entry
Sequence Data
>SC333202 representing NM_001272068.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTTCCCGTGGACTCAGCCTCTTCCCCGAGTCCTGTCCAGATTTCTGCTGTGGTACCTGTGATGAC
CAATACTGCTGCTCTGACGTGCTGAAGAAATTTGTGTGGAGCGAGGAAAGGTGTGCTGTGCCTGAGGCC
AGCGTGCCTGCCAGTGTAGAGCCGGTGGAGCAGCTGGGCTCGGCGCTGAGGTTTCGCCCTGGCTACAAC
GACCCCATGTCAGGGTTCGGAGCGACCTTGGCCGTTGGCCTGACCATCTTTGTGCTGTCTGTCGTCACT
ATCATCATCTGCTTCACCTGCTCCTGCTGCTGCCTTTACAAGACGTGCCGCCGACCACGTCCGGTTGTC
ACCACCACCACATCCACCACTGTGGTGCATGCCCCTTATCCTCAGCCTCCAAGTGTGCCGCCCAGCTAC
CCTGGACCAAGCTACCAGGGCTACCACACCATGCCGCCTCAGCCAGGGATGCCAGCAGCACCCTACCCA
ATGCAGTACCCACCACCTTACCCAGCCCAGCCCATGGGCCCACCGGCCTACCACGAGACCCTGGCTGGA
GGAGCAGCCGCGCCCTACCCCGCCAGCCAGCCTCCTTACAACCCGGCCTACATGGATGCCCCGAAGGCG
GCCCTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001272068
Insert Size 630 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001272068.1
RefSeq Size 2385 bp
RefSeq ORF 630 bp
Locus ID 51246
UniProt ID Q8N114
Protein Families Transmembrane
Protein Pathways p53 signaling pathway
MW 22.4 kDa
Gene Summary This gene encodes a member of the shisa family. The encoded protein is localized to the endoplasmic reticulum, and together with p53 induces apoptosis in a caspase-dependent manner. Alternative splicing results in multiple transcript variants. Related pseudogenes of this gene are found on chromosome X. [provided by RefSeq, Apr 2016]
Transcript Variant: This variant (5) uses two alternate exons in the 5' UTR and initiates translation at a downstream AUG, compared to variant 1. The encoded isoform (c) is shorter than isoform a. Variants 3, 4 and 5 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...