Syntaxin 4 (STX4) (NM_001272095) Human Untagged Clone

CAT#: SC333209

STX4 (untagged) - Homo sapiens syntaxin 4 (STX4), transcript variant 1



  "NM_001272095" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to Syntaxin 4 (syntaxin 4)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms p35-2; STX4A
Vector pCMV6-Entry
Sequence Data
>SC333209 representing NM_001272095.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGCAGGAGCTGCAGAACCTGCGCGATGAGATCAAACAGCTGGGGAGGGAGATCCGCCTGCAGCTG
AAGGCCATAGAGCCCCAGAAGGAGGAAGCTGATGAGAACTATAACTCCGTCAACACAAGAATGAGAAAA
ACCCAGCATGGGGTCCTGTCCCAGCAATTCGTGGAGCTCATCAACAAGTGCAATTCAATGCAGTCCGAA
TACCGGGAGAAGAACGTGGAGCGGATTCGGAGGCAGCTGAAGATCACCAATGCTGGGATGGTGTCTGAT
GAGGAGTTGGAGCAGATGCTGGACAGTGGGCAAAGCGAGGTGTTTGTGTCCAATATCCTGAAGGACACG
CAGGTGACTCGACAGGCCTTAAATGAGATCTCGGCCCGGCACAGTGAGATCCAGCAGCTTGAACGCAGT
ATTCGTGAGCTGCACGACATATTCACTTTTCTGGCTACCGAAGTGGAGATGCAGGGGGAGATGATCAAT
CGGATTGAGAAGAACATCCTGAGCTCAGCGGACTACGTGGAACGTGGGCAGGAGCACGTCAAGACGGCC
CTGGAGAACCAGAAGAAGGCGAGGAAGAAGAAAGTCTTGATTGCCATCTGTGTGTCCATCACCGTCGTC
CTCCTAGCAGTCATCATTGGCGTCACAGTGGTTGGATAA

Restriction Sites SgfI-MluI     
ACCN NM_001272095
Insert Size 660 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001272095.1
RefSeq Size 1630 bp
RefSeq ORF 660 bp
Locus ID 6810
Protein Families Druggable Genome, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
MW 25.3 kDa
Gene Summary Plasma membrane t-SNARE that mediates docking of transport vesicles. Necessary for the translocation of SLC2A4 from intracellular vesicles to the plasma membrane. Together with STXB3 and VAMP2, may also play a role in docking/fusion of intracellular GLUT4-containing vesicles with the cell surface in adipocytes (By similarity). May also play a role in docking of synaptic vesicles at presynaptic active zones.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the shortest protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...