C18orf1 (LDLRAD4) (NM_001276249) Human Untagged Clone
CAT#: SC333222
LDLRAD4 (untagged) - Homo sapiens low density lipoprotein receptor class A domain containing 4 (LDLRAD4), transcript variant d1
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C18orf1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333222 representing NM_001276249.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGTGGTGGTCATCGTCTGCCTGCTGAACCACTACAAAGTCTCCACGCGGTCCTTCATCAACCGCCCG AACCAGAGCCGGAGGCGGGAGGACGGGCTGCCGCAGGAAGGGTGCCTGTGGCCTTCAGACAGCGCCGCA CCGCGGCTGGGCGCCTCGGAGATCATGCATGCCCCGCGGTCCAGGGACAGGTTCACAGCGCCGTCCTTC ATCCAGAGGGATCGCTTCAGCCGCTTCCAGCCCACCTACCCCTATGTGCAGCACGAGATTGATCTTCCT CCCACCATCTCCCTGTCCGACGGTGAAGAGCCACCTCCTTACCAGGGGCCCTGCACCCTGCAGCTCCGG GACCCTGAACAGCAGATGGAACTCAACCGAGAGTCCGTGAGGGCCCCACCCAACCGAACCATATTTGAC AGTGATTTAATAGACATTGCTATGTATAGCGGGGGTCCATGCCCACCCAGCAGCAACTCGGGCATCAGT GCAAGCACCTGCAGCAGTAACGGGAGGATGGAGGGGCCACCCCCCACATACAGCGAGGTGATGGGCCAC CACCCAGGCGCCTCTTTCCTCCATCACCAGCGCAGCAACGCACACAGGGGCAGCAGACTGCAGTTTCAG CAGAACAATGCAGAGAGCACAATAGTACCCATCAAAGGCAAAGATAGGAAGCCTGGGAACCTGGTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001276249 |
Insert Size | 690 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001276249.1 |
RefSeq Size | 8138 bp |
RefSeq ORF | 690 bp |
Locus ID | 753 |
UniProt ID | O15165 |
Protein Families | Druggable Genome, Transmembrane |
MW | 25.6 kDa |
Gene Summary | Functions as a negative regulator of TGF-beta signaling and thereby probably plays a role in cell proliferation, differentiation, apoptosis, motility, extracellular matrix production and immunosuppression. In the canonical TGF-beta pathway, ZFYVE9/SARA recruits the intracellular signal transducer and transcriptional modulators SMAD2 and SMAD3 to the TGF-beta receptor. Phosphorylated by the receptor, SMAD2 and SMAD3 then form a heteromeric complex with SMAD4 that translocates to the nucleus to regulate transcription. Through interaction with SMAD2 and SMAD3, LDLRAD4 may compete with ZFYVE9 and SMAD4 and prevent propagation of the intracellular signal.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (d1) contains an alternate 5' terminal exon, differs in its 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant a1. The encoded isoform (delta 1) is shorter at the N-terminus, compared to isoform alpha 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233493 | LDLRAD4 (Myc-DDK tagged) - Homo sapiens low density lipoprotein receptor class A domain containing 4 (LDLRAD4), transcript variant d1 |
CNY 3,990.00 |
|
RG233493 | LDLRAD4 (tGFP-tagged) - Homo sapiens low density lipoprotein receptor class A domain containing 4 (LDLRAD4), transcript variant d1 |
CNY 4,370.00 |
其它C18orf1产品