C19orf12 (NM_001282931) Human Untagged Clone

CAT#: SC333379

C19orf12 (untagged) - Human chromosome 19 open reading frame 12 (C19orf12), transcript variant 7



  "NM_001282931" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MPAN; NBIA3; NBIA4; SPG43
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333379 representing NM_001282931.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACAAGTGGACAGTTTAAGCCGGTTCCTCAGATCCTAATGGAGCTGCCCCCTGCCGAGCAACAGAGG
CTCTTTAACGAAGCCGCAGCCATCATCAGGCACCTGGAGTGGACGGACGCCGTGCAGCTGACCGCGCTG
GTCATGGGCAGCGAGGCCCTGCAGCAGCAGCTGCTGGCCATGCTGGTGAACTACGTCACCAAGGAGCTG
CGGGCCGAGATCCAGTATGATGACTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282931
Insert Size 234 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282931.1
RefSeq Size 4804 bp
RefSeq ORF 234 bp
Locus ID 83636
UniProt ID Q9NSK7
Protein Families Transmembrane
MW 8.8 kDa
Gene Summary This gene encodes a small transmembrane protein. Mutations in this gene are a cause of neurodegeneration with brain iron accumulation-4 (NBIA4), but the specific function of the encoded protein is unknown. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (7) uses an alternate 5' structure and thus differs in the 5' UTR and 5' coding region compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (4) with a shorter N-terminus, compared to isoform. Variants 5, 6, and 7 encode the same isoform (4). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...