OPALIN (NM_001284327) Human Untagged Clone
CAT#: SC333389
OPALIN (untagged) - Human oligodendrocytic myelin paranodal and inner loop protein (OPALIN), transcript variant 10
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HTMP10; TMEM10; TMP10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333389 representing NM_001284327.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGGAAAGTGACAGACCATGTGAAATTTCAGAAATTGATGACAATCCCAAGATATCTGAGAATCCT AGGAGATCACCCACACATGAGAAGAATACGATGGGAGCACAAGAGGCCCACATATATGTGAAGACTGTA GCAGGAAGCGAGGAACCTGTGCATGACCGTTACCGTCCTACTATAGAAATGGAAAGAAGGAGGGGATTG TGGTGGCTTGTGCCCAGACTGAGCCTGGAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001284327 |
Insert Size | 240 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001284327.1 |
RefSeq Size | 3306 bp |
RefSeq ORF | 240 bp |
Locus ID | 93377 |
UniProt ID | Q96PE5 |
Protein Families | Transmembrane |
MW | 9.3 kDa |
Gene Summary | Central nervous system-specific myelin protein that increase myelin genes expression during oligodendrocyte differentiation. Promotes oligodendrocyte terminal differentiation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (10) uses an alternate 5' terminal exon and uses a downstream start codon compared to variant 1. It encodes isoform f which has a shorter N-terminus compared to isoform a. Variants 9 and 10 encode the same isoform (f). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235495 | OPALIN (myc-DDK-tagged) - Human oligodendrocytic myelin paranodal and inner loop protein (OPALIN), transcript variant 10 |
CNY 3,990.00 |
|
RG235495 | OPALIN (tGFP-tagged) - Human oligodendrocytic myelin paranodal and inner loop protein (OPALIN), transcript variant 10 |
CNY 4,370.00 |