OPALIN (NM_001284327) Human Untagged Clone

CAT#: SC333389

OPALIN (untagged) - Human oligodendrocytic myelin paranodal and inner loop protein (OPALIN), transcript variant 10



  "NM_001284327" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HTMP10; TMEM10; TMP10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333389 representing NM_001284327.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGAAAGTGACAGACCATGTGAAATTTCAGAAATTGATGACAATCCCAAGATATCTGAGAATCCT
AGGAGATCACCCACACATGAGAAGAATACGATGGGAGCACAAGAGGCCCACATATATGTGAAGACTGTA
GCAGGAAGCGAGGAACCTGTGCATGACCGTTACCGTCCTACTATAGAAATGGAAAGAAGGAGGGGATTG
TGGTGGCTTGTGCCCAGACTGAGCCTGGAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001284327
Insert Size 240 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001284327.1
RefSeq Size 3306 bp
RefSeq ORF 240 bp
Locus ID 93377
UniProt ID Q96PE5
Protein Families Transmembrane
MW 9.3 kDa
Gene Summary Central nervous system-specific myelin protein that increase myelin genes expression during oligodendrocyte differentiation. Promotes oligodendrocyte terminal differentiation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (10) uses an alternate 5' terminal exon and uses a downstream start codon compared to variant 1. It encodes isoform f which has a shorter N-terminus compared to isoform a. Variants 9 and 10 encode the same isoform (f).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...