CD45 (PTPRC) (NM_001267798) Human Untagged Clone
CAT#: SC333434
PTPRC (untagged) - Human protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 5
CNY 1,320.00
CNY 2,950.00
货期*
现货
规格
Product images
经常一起买 (4)
PTPRC mouse monoclonal antibody, clone OTI4C11 (formerly 4C11)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | B220; CD45; CD45R; GP180; L-CA; LCA; LY5; T200 |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001267798, the custom clone sequence may differ by one or more nucleotides
ATGACCATGTATTTGTGGCTTAAACTCTTGGCATTTGGCTTTGCCTTTCTGGACACAGAAGTATTTGTGA CAGGGCAAAGCCCAACACCTTCCCCCACTGGCCATCTGCAAGCTGAGGAGCAAGGAAGCCAATCCAAGTC ACCAAACCTCAAAAGTAGGGAAGCTGACAGTTCAGCCTTCAGTTGGTGGCCAAAGGCCCGAGAGCCCCTC ACAAACCACTGGAGTAAGTCCAAGAGTCCAAAAGCTGAGGAACTTGGAGTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001267798 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001267798.1, NP_001254727.1 |
RefSeq Size | 1477 bp |
RefSeq ORF | 264 bp |
Locus ID | 5788 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Phosphatase, Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs), Fc gamma R-mediated phagocytosis, Primary immunodeficiency, T cell receptor signaling pathway |
Gene Summary | The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012] Transcript Variant: This variant (5) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (5) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...