C1orf150 (GCSAML) (NM_001281837) Human Untagged Clone
CAT#: SC333507
GCSAML (untagged) - Human germinal center-associated, signaling and motility-like (GCSAML), transcript variant 5
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C1orf150 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333507 representing NM_001281837.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACTACATTTGAAAGAAAACTTCAAGATCAAGATAAGAAAAGCCAAGAAGTTTCATCCACTTCTAAT CAGGAAAACGAGAATGGCAGTGGTTCTGAAGAAGTGTGCTACACTGTCATTAATCACATCCCCCATCAG AGATCCTCCCTGAGCTCCAATGATGATGGCTATGAGAACATTGACTCCCTCACAAGGAAAGTGAGACAG TTTAGAGAAAGGTCAGAGACAGAATATGCCCTTCTTAGGACTTCTGTTAGTAGGCCTTGTTCCTGCACC CATGAGCATGATTATGAAGTTGTGTTTCCACACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001281837 |
Insert Size | 312 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001281837.1 |
RefSeq Size | 3959 bp |
RefSeq ORF | 312 bp |
Locus ID | 148823 |
UniProt ID | Q5JQS6 |
MW | 11.9 kDa |
Gene Summary | This gene encodes a protein thought to be a signaling molecule associated with germinal centers, the sites of proliferation and differentiation of mature B lymphocytes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (5) contains multiple alternate exons in the 5' UTR, lacks an in-frame exon and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (c) is shorter than isoform a. Variants 4, 5 and 6 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235613 | GCSAML (myc-DDK-tagged) - Human germinal center-associated, signaling and motility-like (GCSAML), transcript variant 5 |
CNY 3,990.00 |
|
RG235613 | GCSAML (tGFP-tagged) - Human germinal center-associated, signaling and motility-like (GCSAML), transcript variant 5 |
CNY 4,370.00 |
其它C1orf150产品