Diazepam Binding Inhibitor (DBI) (NM_001282633) Human Untagged Clone

CAT#: SC333523

DBI (untagged) - Human diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) (DBI), transcript variant 8



  "NM_001282633" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DBI mouse monoclonal antibody,clone OTI6E12
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ACBD1; ACBP; CCK-RP; EP
Vector pCMV6-Entry
Sequence Data
>SC333523 representing NM_001282633.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGGGGCGACCTCTGGCTCCTCCCGCCTGCCTCTGCCAATCCGGGCACTGGGACAGAGGCTGAGTTT
GAGAAAGCTGCAGAGGAGGTTAGGCACCTTAAGACCAAGCCATCGGATGAGGAGATGCTGTTCATCTAT
GGCCACTACAAACAAGCAACTGTGGGCGACATAAATACAGAACGGCCCGGGATGTTGGACTTCACGGGC
AAGGCCAAGTGGGATGCCTGGAATGAGCTGAAAGGGACTTCCAAGGAAGATGCCATGAAAGCTTACATC
AACAAAGTAGAAGAGCTAAAGAAAAAATACGGGATATGA

Restriction Sites SgfI-MluI     
ACCN NM_001282633
Insert Size 315 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282633.1
RefSeq Size 750 bp
RefSeq ORF 315 bp
Locus ID 1622
UniProt ID P07108
Protein Families Druggable Genome
Protein Pathways PPAR signaling pathway
MW 11.8 kDa
Gene Summary This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (8) has an alternate splice site and an alternate exon in the 5' region, which results in an alternate translation start codon, compared to variant 5. The resulting isoform (1) has a shorter and distinct N-terminus, compared to isoform 5. Variants 1, 7, 8, 9, and 10 encode the same isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Diazepam Binding Inhibitor产品

Customer Reviews 
Loading...