MARK1 (NM_001286129) Human Untagged Clone

CAT#: SC333553

MARK1 (untagged) - Human MAP/microtubule affinity-regulating kinase 1 (MARK1), transcript variant 5



  "NM_001286129" in other vectors (2)

CNY 1,320.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-MARK1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MARK; Par-1c; Par1c
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333553 representing NM_001286129.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGGCCCGGACGCCATTGCCGACGGTGAACGAGCGGGACACGGAAAATCATACATCTGTGGATGGA
TATACTGAACCACACATCCAGCCTACCAAGTCGAGTAGCAGACAGAACATCCCCCGGTGTAGAAACTCC
ATTACGTCAGCAACAGATGAACAGCCTCACATTGGAAATTACCGTTTACAAAAAACAATAGGGAAGGGA
AATTTTGCCAAAGTCAAATTGGCAAGACACGTTCTAACTGGTAGAGAGGTTGCTGTGAAAATAATAGAC
AAAACTCAGCTAAATCCTACCAGTCTACAAAAGGTATTTAATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286129
Insert Size 321 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286129.1
RefSeq Size 2747 bp
RefSeq ORF 321 bp
Locus ID 4139
Protein Families Druggable Genome, Protein Kinase
MW 11.9 kDa
Gene Summary Serine/threonine-protein kinase (PubMed:23666762). Involved in cell polarity and microtubule dynamics regulation. Phosphorylates DCX, MAP2 and MAP4. Phosphorylates the microtubule-associated protein MAPT/TAU (PubMed:23666762). Involved in cell polarity by phosphorylating the microtubule-associated proteins MAP2, MAP4 and MAPT/TAU at KXGS motifs, causing detachment from microtubules, and their disassembly. Involved in the regulation of neuronal migration through its dual activities in regulating cellular polarity and microtubule dynamics, possibly by phosphorylating and regulating DCX. Also acts as a positive regulator of the Wnt signaling pathway, probably by mediating phosphorylation of dishevelled proteins (DVL1, DVL2 and/or DVL3).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) differs in the 3' UTR and has multiple coding region differences, compared to variant 1, one of which results in a frameshift. The resulting protein (isoform 5) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...