PGPEP1 (NM_001300927) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	PAP-I; Pcp; PGI; PGP; PGP-I; PGPI
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC333580 representing NM_001300927. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGCAGCCGAGGAAGGCGGTGGTAGTGACGGGATTTGGCCCTTTTGGGGAACACACCGTGAACGCC AGTTGGATTGCAGTTCAGGAGCTAGAAAAGCTAGGCCTTGGCGACAGCGTGGACCTGCATGTGTACGAG ATTCCGGTTGAGTACCAAACAGTCCAGAGACTCATCCCCGCCCTGTGGGAGAAGCACAGTCCACAGATA TCTCTGCGACTTTACCTACTACACCTCTTTGTACCAGAGTCACGGTCGATCAGCCTTCGTCCACGTGCC CCCACTGGGGAAGCCGTACAACGCGGACCAGCTGGGCAGGGCACTGAGAGCCATCATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001300927
Insert Size	336 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001300927.1
RefSeq Size	6862 bp
RefSeq ORF	336 bp
Locus ID	54858
UniProt ID	Q9NXJ5
Protein Families	Druggable Genome, Protease
MW	12.4 kDa
Gene Summary	The gene encodes a cysteine protease and member of the peptidase C15 family of proteins. The encoded protein cleaves amino terminal pyroglutamate residues from protein substrates including thyrotropin-releasing hormone and other neuropeptides. Expression of this gene may be downregulated in colorectal cancer, while activity of the encoded protein may be negatively correlated with cancer progression in colorectal cancer patients. Activity of the encoded protease may also be altered in other disease states including in liver cirrhosis, which is associated with reduced protease activity, and in necrozoospermia, which is associated with elevated protease activity. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (2) lacks an alternate exon in the coding region, resulting in a frameshift and an early stop codon, compared to variant 1. It encodes isoform 2, which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.