HSPC152 (TRMT112) (NM_001286082) Human Untagged Clone
CAT#: SC333669
TRMT112 (untagged) - Human tRNA methyltransferase 11-2 homolog (S. cerevisiae) (TRMT112), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HSPC152; HSPC170; hTrm112; TRM112; TRMT11-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333669 representing NM_001286082.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAACTGCTTACCCACAATCTGCTGAGCTCGCATGTGCGGGGGGTGGGGTCCCGTGGCTTCCCCCTG CGCCTCCAGGCCACCGAGGTCCGTATCTGCCCTGTGGAATTCAACCCCAACTTCGTGGCGCGTATGATA CCTAAAGTGGAGTGGTCGGCGTTCCTGGAGGCGGCCGATAACGTGCCGAAAGGGCCGGTTGAGGGATAT GAGGAGAATGAGGAGTTTCTGAGGACCATGCACCACCTGCTGCTGGAGGTGGAAGTGATAGAGGGCACC CTGCAGTGCCCGGAATCTGGACGTATGTTCCCCATCAGCCGCGGGATCCCCAACATGCTGCTGAGTGAA GAGGAAACTGAGAGTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286082 |
Insert Size | 363 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286082.1 |
RefSeq Size | 1290 bp |
RefSeq ORF | 363 bp |
Locus ID | 51504 |
UniProt ID | Q9UI30 |
MW | 13.6 kDa |
Gene Summary | Acts as an activator of both rRNA/tRNA and protein methyltransferases (PubMed:25851604). Together with methyltransferase BUD23, methylates the N(7) position of a guanine in 18S rRNA (PubMed:25851604). The heterodimer with HEMK2/N6AMT1 catalyzes N5-methylation of ETF1 on 'Gln-185', using S-adenosyl L-methionine as methyl donor (PubMed:18539146). The heterodimer with ALKBH8 catalyzes the methylation of 5-carboxymethyl uridine to 5-methylcarboxymethyl uridine at the wobble position of the anticodon loop in target tRNA species (PubMed:20308323). Involved in the pre-rRNA processing steps leading to small-subunit rRNA production (PubMed:25851604).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice site, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235775 | TRMT112 (myc-DDK-tagged) - Human tRNA methyltransferase 11-2 homolog (S. cerevisiae) (TRMT112), transcript variant 2 |
CNY 3,990.00 |
|
RG235775 | TRMT112 (tGFP-tagged) - Human tRNA methyltransferase 11-2 homolog (S. cerevisiae) (TRMT112), transcript variant 2 |
CNY 4,370.00 |
其它HSPC152产品