Pirh2 (RCHY1) (NM_001278539) Human Untagged Clone
CAT#: SC333820
RCHY1 (untagged) - Human ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase (RCHY1), transcript variant 9
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARNIP; CHIMP; PIRH2; PRO1996; RNF199; ZCHY; ZNF363 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333820 representing NM_001278539.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAATCTTCAAGGAAGACACAAGTGTATTGAAAATGTGTCCCGACAGAATTGTCCAATATGTTTGGAG GACATTCACACATCCCGTGTTGTTGCTCATGTCTTGCCATGTGGACATCTTTTACATAGAACGTGTTAT GAAGAAATGTTGAAAGAAGGCTACAGATGTCCATTATGTATGCACTCTGCTTTAGATATGACCAGGTAT TGGAGACAGCTGGATGATGAAGTAGCACAGACTCCTATGCCATCAGAATATCAGAACATGACTGTGGAT ATTCTCTGCAATGACTGTAATGGACGATCCACTGTTCAGTTTCATATATTAGGCATGAAATGTAAGATT TGTGAATCCTATAATACTGCTCAAGCTGGAGGACGTAGAATTTCACTGGATCAGCAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278539 |
Insert Size | 405 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278539.1 |
RefSeq Size | 4469 bp |
RefSeq ORF | 405 bp |
Locus ID | 25898 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Protein Pathways | p53 signaling pathway, Ubiquitin mediated proteolysis |
MW | 15.4 kDa |
Gene Summary | The protein encoded by this gene has ubiquitin ligase activity. It mediates E3-dependent ubiquitination and proteasomal degradation of target proteins, including tumor protein 53, histone deacetylase 1, and cyclin-dependent kinase inhibitor 1B, thus regulating their levels and cell cycle progression. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (9) uses an alternate splice site in the 5' terminal exon, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (7) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235926 | RCHY1 (myc-DDK-tagged) - Human ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase (RCHY1), transcript variant 9 |
CNY 3,990.00 |
|
RG235926 | RCHY1 (tGFP-tagged) - Human ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase (RCHY1), transcript variant 9 |
CNY 4,370.00 |