SNX3 (NM_001300929) Human Untagged Clone

CAT#: SC333870

SNX3 (untagged) - Human sorting nexin 3 (SNX3), transcript variant 4



  "NM_001300929" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SNX3 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Grd19; MCOPS8; SDP3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333870 representing NM_001300929.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGAGACCGTGGCTGACACCCGGCGGCTGATCACCAAGCCGCAGAACCTGAATGACGCCTACGGA
CCCCCCAGCAACTTCCTCGAGATCGATACAAATCTTCCTATTTTCAAGCTGAAAGAATCTACTGTTAGA
AGAAGATACAGTGACTTTGAATGGCTGCGAAGTGAATTAGAAAGAGAGAGCAAGGTCGTAGTTCCCCCG
CTCCCTGGGAAAGCGTTTTTGCGTCAGCTTCCTTTTAGAGGAGATGATGGAATATTTGATGACAATTTT
ATTGAGGAAAGAAAACAAGGGCTGGAGCAGTTTATAAACAAGGTCGCTGGTCATCCTCTGGCACAGAAC
GAACGTTGTCTTCACATGTTTTTACAAGATGAAATAATAGATAAAAGCTATACTCCATCTAAAATAAGA
CATGCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001300929
Insert Size 423 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001300929.1
RefSeq Size 1711 bp
RefSeq ORF 423 bp
Locus ID 8724
UniProt ID O60493
MW 16.3 kDa
Gene Summary This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like most family members. This protein interacts with phosphatidylinositol-3-phosphate, and is involved in protein trafficking. A pseudogene of this gene is present on the sex chromosomes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) lacks an in-frame portion of the first coding exon, compared to variant 1. It encodes isoform d, which is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...