PTTG1IP (NM_001286822) Human Untagged Clone

CAT#: SC333891

PTTG1IP (untagged) - Human pituitary tumor-transforming 1 interacting protein (PTTG1IP), transcript variant 2



  "NM_001286822" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-PTTG antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C21orf1; C21orf3; PBF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333891 representing NM_001286822.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCCCGGAGTGGCCCGCGGGCCGACGCCGTACTGGAGGTTGCGCCTCGGTGGCGCCGCGCTGCTC
CTGCTGCTCATCCCGGTGGCCGCCGCGCAGGAGCCTCCCGGAGCTGCTTGTTCTCAGAACACAAACAAA
ACCTGTGAAGAGTGCCTGAAGAACGTCTCCGCCTGTTTAAAGAAGAAAACCCGTATGCTAGATTTGAAA
ACAACTAAAGCGCTCCAGCACATCAGTCCCGACGCTTCCTGTGAGGTGCACGCTCCGCAGCCCAGCCCA
GCCGGGAGACCACGTGGCCATTGCGGTCTCCTGACCTTGGCCAGTGAACCTGCCAGCCTTCCAGGACAG
GCGGCCGGAGAGCTGCCCCTGAAGGACAGTCCTCTCGTCTTGCAGACTGGTGACCTTCTATTCCCTGTT
CATCTCTGTTTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286822
Insert Size 429 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286822.1
RefSeq Size 2515 bp
RefSeq ORF 429 bp
Locus ID 754
UniProt ID P53801
Protein Families Druggable Genome, Transmembrane
MW 14.9 kDa
Gene Summary This gene encodes a single-pass type I integral membrane protein, which binds to pituitary tumor-transforming 1 protein (PTTG1), and facilitates translocation of PTTG1 into the nucleus. Coexpression of this protein and PTTG1 induces transcriptional activation of basic fibroblast growth factor. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (2) lacks 3 consecutive exons, which cause a frame-shift compared to variant 1. The resulting shorter isoform (2) has a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...