Siglec 7 (SIGLEC7) (NM_001277201) Human Untagged Clone

CAT#: SC333926

SIGLEC7 (untagged) - Human sialic acid binding Ig-like lectin 7 (SIGLEC7), transcript variant 3



  "NM_001277201" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
SIGLEC7 mouse monoclonal antibody, clone OTI1A1 (formerly 1A1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AIRM-1; AIRM1; CD328; CDw328; D-siglec; p75; p75/AIRM1; QA79; SIGLEC-7; SIGLEC19P; SIGLECP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333926 representing NM_001277201.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGCTGCTGCTGCTGCTGCCCCTGCTCTGGGGGAGGGAGAGGGTGGAAGGACAGAAGAGTAACCGG
AAGGATTACTCGCTGACGATGCAGAGTTCCGTGACCGTGCAAGAGGGCATGTGTGTCCATGTGCGCTGC
TCCTTCTCCTACCCAGTGGACAGCCAGACTGACTCTGACCCAGTTCATGGCTACTGGTTCCGGGCAGGG
AATGATATAAGCTGGAAGGCTCCAGTGGCCACAAACAACCCAGCTTGGGCAGTGCAGGAGGAAACTCGG
GACCGATTCCACCTCCTTGGGGACCCACAGACCAAAAATTGCACCCTGAGCATCAGAGATGCCAGAATG
AGTGATGCGGGGAGATACTTCTTTCGTATGGAGAAAGGAAATATAAAATGGAATTATAAATATGACCAG
CTCTCTGTGAACGTGACAGGGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001277201
Insert Size 438 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001277201.1
RefSeq Size 981 bp
RefSeq ORF 438 bp
Locus ID 27036
UniProt ID Q9Y286
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
MW 16.7 kDa
Gene Summary Putative adhesion molecule that mediates sialic-acid dependent binding to cells. Preferentially binds to alpha-2,3- and alpha-2,6-linked sialic acid. Also binds disialogangliosides (disialogalactosyl globoside, disialyl lactotetraosylceramide and disialyl GalNAc lactotetraoslylceramide). The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface. In the immune response, may act as an inhibitory receptor upon ligand induced tyrosine phosphorylation by recruiting cytoplasmic phosphatase(s) via their SH2 domain(s) that block signal transduction through dephosphorylation of signaling molecules. Mediates inhibition of natural killer cells cytotoxicity. May play a role in hemopoiesis. Inhibits differentiation of CD34+ cell precursors towards myelomonocytic cell lineage and proliferation of leukemic myeloid cells (in vitro).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks all internal coding exons, compared to variant 1. The resulting isoform (3) is C-terminal truncated, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...