RNASE4 (NM_001282193) Human Untagged Clone

CAT#: SC333938

RNASE4 (untagged) - Human ribonuclease, RNase A family, 4 (RNASE4), transcript variant 5



  "NM_001282193" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RNASE4 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RAB1; RNS4
Vector pCMV6-Entry
Sequence Data
>SC333938 representing NM_001282193.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTCTGCAGAGGACCCATTCATTGCTTCTGCTTTTGCTGCTGACCCTGCTGGGGCTGGGGCTGGTC
CAGCCCTCCTATGGCCAGGATGGCATGTACCAGCGATTCCTGCGGCAACACGTGCACCCTGAGGAGACA
GGTGGCAGTGATCGCTACTGCAACTTGATGATGCAAAGACGGAAGATGACTTTGTATCACTGCAAGCGC
TTCAACACCTTCATCCATGAAGATATCTGGAACATTCGTAGTATCTGCAGCACCACCAATATCCAATGC
AAGAACGGCAAGATGAACTGCCATGAGGGTGTAGTGAAGGTCACAGATTGCAGGGACACAGGAAGTTCC
AGGGCACCCAACTGCAGATATCGGGCCATAGCGAGCACTAGACGTGTTGTCATTGCCTGTGAGGGTAAC
CCACAGGTGCCTGTGCACTTTGACGGTTAG

Restriction Sites SgfI-MluI     
ACCN NM_001282193
Insert Size 444 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282193.1
RefSeq Size 1746 bp
RefSeq ORF 444 bp
Locus ID 6038
UniProt ID P34096
Protein Families Secreted Protein, Transmembrane
MW 16.8 kDa
Gene Summary The protein encoded by this gene belongs to the pancreatic ribonuclease family. It plays an important role in mRNA cleavage and has marked specificity towards the 3' side of uridine nucleotides. Alternative splicing results in four transcript variants encoding the same protein. This gene and the gene that encodes angiogenin share promoters and 5' exons. Each gene splices to a unique downstream exon that contains its complete coding region. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 4. All four variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...