TMED3 (NM_001301203) Human Untagged Clone
CAT#: SC334014
TMED3 (untagged) - Human transmembrane emp24 protein transport domain containing 3 (TMED3), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C15orf22; P24B; p24g4; p24gamma4; p26 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC334014 representing NM_001301203.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCAGCACTGTCCCGCGCTCCGCCTCCGTGCTGCTTCTGCTGCTGCTCCTGCGCCGGGCCGAGCAG CCCTGCGGGGCCGAGCTCACCTTCGAGCTGCCGGACAACGCCAAGCAGTGCTTCCACGAGGAGGTGGAG CAGGGCGTGAAGTTCTCCCTGGATTACCAGGTCATCACTGGAGGCCACTACGATGTTGACTGCTATGTA GAGGACCCCCAGGGGAACACCATCTACAGAGAAACGAAGAAGCAGTACGACAGCTTCACGTACCGGGCT GAAGTCAAGGGCGTTTATCAGTTTTGCTTCAGTAATGAGTTTTCCACCTTCTCTCACAAGACCGTCTAC TTTGACTTTCAAGTGGGCGATGAGCCTCCCATTCTCCCAGACATGGGGAACAGGGTCACAGCTCTCACC CAGGGTCCCAGTGCTTCACCAACACCAACGCCACCACTAAGGGTTCCAGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301203 |
Insert Size | 468 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001301203.1 |
RefSeq Size | 2370 bp |
RefSeq ORF | 468 bp |
Locus ID | 23423 |
Protein Families | Transmembrane |
MW | 17.4 kDa |
Gene Summary | Potential role in vesicular protein trafficking, mainly in the early secretory pathway. Contributes to the coupled localization of TMED2 and TMED10 in the cis-Golgi network.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains an alternate 3' terminal exon and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (b) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236120 | TMED3 (myc-DDK-tagged) - Human transmembrane emp24 protein transport domain containing 3 (TMED3), transcript variant 2 |
CNY 3,990.00 |
|
RG236120 | TMED3 (tGFP-tagged) - Human transmembrane emp24 protein transport domain containing 3 (TMED3), transcript variant 2 |
CNY 4,370.00 |