DNA Primase (PRIM2) (NM_001282487) Human Untagged Clone

CAT#: SC334049

PRIM2 (untagged) - Human primase, DNA, polypeptide 2 (58kDa) (PRIM2), transcript variant 2



  "NM_001282487" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
PRIM2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms p58; PRIM2A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334049 representing NM_001282487.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGTTTTCTGGAAGAAAGTGGAGGAAGCTGAGGTTGGCAGGTGACCAGAGGAATGCTTCCTACCCT
CATTGCCTTCAGTTTTACTTGCAGCCACCTTCTGAAAACATATCTTTAATAGAATTTGAAAACTTGGCT
ATTGATAGAGTTAAATTGTTAAAATCAGTTGAAAATCTTGGAGTGAGCTATGTGAAAGGAACTGAACAA
TACCAGAGTAAGTTGGAGAGTGAGCTTCGGAAGCTCAAGTTTTCCTACAGAGAAAACTTAGAAGATGAA
TATGAACCACGAAGAAGAGATCATATTTCTCATTTTATTTTGCGGCTTGCTTATTGCCAGTCTGAAGAA
CTTAGACGCTGGTTCATTCAACAAGAAATGGATCTCCTTCGATTTAGATTTAGTATTTTACCCAAGGAT
AAAATTCAGGATTTCTTAAAGGATAGCCAATTGCAGTTTGAGGCTGTAAGTATATTTTTGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282487
Insert Size 477 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282487.1
RefSeq Size 871 bp
RefSeq ORF 477 bp
Locus ID 5558
UniProt ID P49643
Protein Pathways DNA replication, Metabolic pathways, Purine metabolism, Pyrimidine metabolism
MW 19.1 kDa
Gene Summary This gene encodes the 58 kilodalton subunit of DNA primase, an enzyme that plays a key role in the replication of DNA. The encoded protein forms a heterodimer with a 49 kilodalton subunit. This heterodimer functions as a DNA-directed RNA polymerase to synthesize small RNA primers that are used to create Okazaki fragments on the lagging strand of the DNA. Alternative splicing of this gene results in multiple transcript variants. This gene has a related pseudogene, which is also present on chromosome 6. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (2) lacks multiple 3' coding exons and its 3' terminal exon extends past a splice site used in variant 1, resulting in a distinct 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus, compared to isoform a. Variants 2 and 3 encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...