TAL1 (NM_001290406) Human Untagged Clone
CAT#: SC334150
TAL1 (untagged) - Human T-cell acute lymphocytic leukemia 1 (TAL1), transcript variant 6
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
TAL1 mouse monoclonal antibody, clone OTI5H1 (formerly 5H1)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHa17; SCL; tal-1; TCL5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001290406, the custom clone sequence may differ by one or more nucleotides
ATGTTCACCACCAACAATCGAGTGAAGAGGAGACCTTCCCCCTATGAGATGGAGATTACTGATGGTCCCC ACACCAAAGTTGTGCGGCGTATCTTCACCAACAGCCGGGAGCGATGGCGGCAGCAGAATGTGAACGGGGC CTTTGCCGAGCTCCGCAAGCTGATCCCCACACATCCCCCGGACAAGAAGCTCAGCAAGAATGAGATCCTC CGCCTGGCCATGAAGTATATCAACTTCTTGGCCAAGCTGCTCAATGACCAGGAGGAGGAGGGCACCCAGC GGGCCAAGACTGGCAAGGACCCTGTGGTGGGGGCTGGTGGGGGTGGAGGTGGGGGAGGGGGCGGCGCGCC CCCAGATGACCTCCTGCAAGACGTGCTTTCCCCCAACTCCAGCTGCGGCAGCTCCCTGGATGGGGCAGCC AGCCCGGACAGCTACACGGAGGAGCCCGCGCCCAAGCACACGGCCCGCAGCCTCCATCCTGCCATGCTGC CTGCCGCCGATGGAGCCGGCCCTCGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001290406 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001290406.1, NP_001277335.1 |
RefSeq Size | 4171 bp |
RefSeq ORF | 519 bp |
Locus ID | 6886 |
UniProt ID | P17542 |
Protein Families | Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
Gene Summary | Implicated in the genesis of hemopoietic malignancies. It may play an important role in hemopoietic differentiation. Serves as a positive regulator of erythroid differentiation (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (6) lacks three consecutive internal exons in the 5' region and uses a downstream translation start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...