LETM2 (NM_001286821) Human Untagged Clone
CAT#: SC334173
LETM2 (untagged) - Human leucine zipper-EF-hand containing transmembrane protein 2 (LETM2), transcript variant 6
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SLC55A2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286821, the custom clone sequence may differ by one or more nucleotides
ATGGCCTTCTACAGTTATAATTCAGTTCTGGCTATTGCTCGAACAAGATTCCCTAGCCATTTTGTCCATC CTACCTGCTCTTCTTATTCCCCATCATGTGCATTTCTTCACTTGCCAGATTCCCATTTAAATAAGACATG TATGAAGAACTATGAGAGCAAGAAGTACTCGGATCCTAGTCAGCCAGGCAATACAGTACTTCACCCAGGA ACTAGACTAATACAAAAGCTACACACATCCACTTGCTGGCTGCAAGAAGTTCCTGGCAAACCTCAGCTGG AGCAAGCCACAAAACATCCACAGGTGACAAGCCCTCAGGCCACAAAAGAAACTGGCATGGAGATTAAAGA AGGCAAACAATCTTATAGACAAAAAATCATGGATGAACTAAAATATTATTACAATGGATTCTACTTACTT TGGATTGACGCCAAAGTTGCTGCCAGAATGGTTTGGAGGCTGTTGCATGGACAGGTCCTGACCAGACGAG AGAGACGAAGGGTAGGCAAGAATCATATTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286821 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001286821.1, NP_001273750.1 |
RefSeq Size | 2119 bp |
RefSeq ORF | 522 bp |
Locus ID | 137994 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236279 | LETM2 (myc-DDK-tagged) - Human leucine zipper-EF-hand containing transmembrane protein 2 (LETM2), transcript variant 6 |
CNY 3,990.00 |
|
RG236279 | LETM2 (tGFP-tagged) - Human leucine zipper-EF-hand containing transmembrane protein 2 (LETM2), transcript variant 6 |
CNY 4,370.00 |