RPA34 (RPA2) (NM_001286076) Human Untagged Clone

CAT#: SC334175

RPA2 (untagged) - Human replication protein A2, 32kDa (RPA2), transcript variant 2



  "NM_001286076" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RPA2 mouse monoclonal antibody, clone OTI9A1 (formerly 9A1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms REPA2; RP-A p32; RP-A p34; RPA32
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286076, the custom clone sequence may differ by one or more nucleotides


ATGACAGCTGCACCCATGGACGTTCGCCAGTGGGTTGACACAGATGACACCAGCAGTGAAAACACTGTGG
TTCCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTGAGATCTTTTCAGAACAAAAAGAGCCTGGTAGC
CTTTAAGATCATGCCCCTGGAGGATATGAATGAGTTCACCACACATATTCTGGAAGTGATCAATGCACAC
ATGGTACTAAGCAAAGCCAACAGCCAGCCCTCAGCAGGGAGAGCACCTATCAGCAATCCAGGAATGAGTG
AAGCAGGGAACTTTGGTGGGAATAGCTTCATGCCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTGTT
GAATTTGATTAAGGCTTGTCCAAGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAACCAGCTGAAACAC
ATGTCTGTATCCTCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAGGGGCACATCTATTCTACTGTGG
ATGATGACCATTTTAAATCCACAGATGCAGAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001286076
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286076.1, NP_001273005.1
RefSeq Size 1970 bp
RefSeq ORF 525 bp
Locus ID 6118
UniProt ID P15927
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways DNA replication, Homologous recombination, Mismatch repair, Nucleotide excision repair
Gene Summary This gene encodes a subunit of the heterotrimeric Replication Protein A (RPA) complex, which binds to single-stranded DNA (ssDNA), forming a nucleoprotein complex that plays an important role in DNA metabolism, being involved in DNA replication, repair, recombination, telomere maintenance, and co-ordinating the cellular response to DNA damage through activation of the ataxia telangiectasia and Rad3-related protein (ATR) kinase. The RPA complex protects single-stranded DNA from nucleases, prevents formation of secondary structures that would interfere with repair, and co-ordinates the recruitment and departure of different genome maintenance factors. The heterotrimeric complex has two different modes of ssDNA binding, a low-affinity and high-affinity mode, determined by which oligonucleotide/oligosaccharide-binding (OB) domains of the complex are utilized, and differing in the length of DNA bound. This subunit contains a single OB domain that participates in high-affinity DNA binding and also contains a winged helix domain at its carboxy terminus, which interacts with many genome maintenance protein. Post-translational modifications of the RPA complex also plays a role in co-ordinating different damage response pathways. [provided by RefSeq, Sep 2017]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...