IPP 2 (PPP1R2) (NM_001291505) Human Untagged Clone

CAT#: SC334207

PPP1R2 (untagged) - Human protein phosphatase 1, regulatory (inhibitor) subunit 2 (PPP1R2), transcript variant 3



  "NM_001291505" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal PPP1R2 (Ab-120/121) antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IPP-2; IPP2; PPP1R2A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291505, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCCTCGACGGCCTCGCACCGGCCCATCAAGGGGATCTTGAAGAACAAGACCTCTACGACTTCCT
CTATGGTGGCGTCGGCCGAACAGCCCCGCGGGAATGTCGACGAGGAGCTGAGCAAAAAATCCCAGAAGTG
GGATGAAATGAACATCTTGGCGACGTATCATCCAGCAGACAAAGACTATGGTTTAATGAAAATAGATGAA
CCAAGCACTCCTTACCATAGATTAGCTGCAGCTGAAGGCTTGGAGCCAAAGTATCGGATTCAGGAACAAG
AAAGCAGTGGAGAGGAGGATAGTGACCTCTCACCTGAAGAACGAGAAAAAAAGCGACAATTTGAAATGAA
AAGGAAGCTTCACTACAATGAAGGACTCAATATCAAACTAGCCAGACAATTAATTTCAAAAGACCTACAT
GATGATGATGAAGATGAAGAAATGTTAGAGACTGCAGATGGAGAAAGCATGAATACGGAAGAATCAAATC
AAGGATCTACTCCAAGTGACCAACAGCAAAACAAATTACGAAGTTCATAG


Restriction Sites SgfI-MluI     
ACCN NM_001291505
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001291505.1, NP_001278434.1
RefSeq Size 3390 bp
RefSeq ORF 540 bp
Locus ID 5504
Protein Families Druggable Genome
Gene Summary Protein phosphatase-1 (PP1) is one of the main eukaryotic serine/threonine phosphatases. The protein encoded by this gene binds to the catalytic subunit of PP1, strongly inhibiting its activity. Ten related pseudogenes have been found throughout the human genome. Several splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (3) lacks an alternate in-frame exon and uses an alternate in-frame splice site, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...