TRAF3IP3 (NM_001287754) Human Untagged Clone

CAT#: SC334246

TRAF3IP3 (untagged) - Human TRAF3 interacting protein 3 (TRAF3IP3), transcript variant 2



  "NM_001287754" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-TRAF3IP3 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms T3JAM
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001287754, the custom clone sequence may differ by one or more nucleotides


ATGAAAAAAGTACTACTGGAGATGGAAGACCAGAAAAACAGCTATGAGCAGAAGGCCAAGGAGTCACTGC
AGAAAGTGCTGGAGGAGAAAATGAATGCAGAGCAGCAACTACAGAGCACACAGCGATCCCTGGCCCTGGC
AGAGCAGAAGTGTGAAGAGTGGAGGAGCCAGTATGAGGCTCTGAAGGAGGACTGGAGGACCCTTGGGACC
CAGCACAGGGAGCTGGAGAGCCAACTCCACGTGCTTCAGTCCAAACTGCAGGGAGCAGATAGCAGGGACT
TACAGATGAACCAGGCCCTGCGATTTTTGGAAAATGAGCACCAGCAACTGCAGGCCAAGATTGAATGCCT
GCAAGGGGACAGAGACCTGTGCAGCTTGGATACCCAGGACCTACAAGATCAACTAAAAAGGTCAGAGGCA
GAGAAACTCACCCTGGTGACCAGAGTACAGCAGTTGCAGGGTTTGCTTCAAAATCAATCCTTACAGCTTC
AAGAACAGGAGAAACTCTTAACAAAGAAAGGTCAGCAAATTTATTACCACAAATTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001287754
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287754.1, NP_001274683.1
RefSeq Size 1083 bp
RefSeq ORF 549 bp
Locus ID 80342
UniProt ID Q9Y228
Protein Families Druggable Genome, Transmembrane
Gene Summary The gene encodes a protein that mediates cell growth by modulating the c-Jun N-terminal kinase signal transduction pathway. The encoded protein may also interact with a large multi-protein assembly containing the phosphatase 2A catalytic subunit. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (2) lacks several exons, uses an alternate 5'-terminal exon, initiates translation at a downstream start codon, and its 3'-terminal exon extends past a splice site that is used in variant 1. The encoded isoform (2) has a shorter N-terminus and a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...