BATF2 (NM_001300808) Human Untagged Clone

CAT#: SC334304

BATF2 (untagged) - Human basic leucine zipper transcription factor, ATF-like 2 (BATF2), transcript variant 3



  "NM_001300808" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-BATF2 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SARI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001300808, the custom clone sequence may differ by one or more nucleotides


ATGGATTGTGCCTCCTGCTCAGCTCCAGGGCTCCTGGGCTGCTGGGACCAGGCTGAGGGGCTCCTGGGCC
CTGGCCCACAGGGACAACATGGCTGCCGGGAGCAGCTGGAGCTGTTCCAGACCCCGGGTTCCTGTTACCC
AGCTCAGCCGCTCTCTCCAGGTCCACAGCCTCATGATTCTCCCAGCCTCCTCCAGTGCCCCCTGCCCTCA
CTGTCCCTTGGCCCCGCTGTGGTTGCTGAACCTCCTGTCCAGCTGTCCCCCAGCCCTCTCCTGTTTGCCT
CGCACACTGGTTCCAGCCTGCAGGGGTCTTCCTCTAAGCTCAGTGCCCTCCAGCCCAGCCTCACGGCCCA
AACTGCCCCTCCACAGCCCCTCGAGCTGGAGCATCCCACCAGAGGGAAGCTGGGGTCCTCTCCCGACAAC
CCTTCCTCTGCCCTGGGGCTTGCACGTCTGCAGAGCAGGGAGCACAAACCTGCTCTCTCAGCAGCCACTT
GGCAAGGGCTGGTTGTGGATCCCAGCCCTCACCCTCTCCTGGCCTTTCCTCTGCTCTCCTCTGCTCAAGT
CCACTTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001300808
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001300808.1, NP_001287737.1
RefSeq Size 1955 bp
RefSeq ORF 570 bp
Locus ID 116071
UniProt ID Q8N1L9
Protein Families Transcription Factors
Gene Summary AP-1 family transcription factor that controls the differentiation of lineage-specific cells in the immune system. Following infection, participates in the differentiation of CD8(+) thymic conventional dendritic cells in the immune system. Acts via the formation of a heterodimer with JUN family proteins that recognizes and binds DNA sequence 5'-TGA[CG]TCA-3' and regulates expression of target genes (By similarity). Selectively suppresses CCN1 transcription and hence blocks the downstream cell proliferation signals produced by CCN1 and inhibits CCN1-induced anchorage-independent growth and invasion in several cancer types, such as breast cancer, malignant glioma and metastatic melanoma. Possibly acts by interfering with AP-1 binding to CCN1 promoter.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) has an alternate exon in place of the first two exons compared to variant 1. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...