HPCAL4 (NM_001282396) Human Untagged Clone

CAT#: SC334325

HPCAL4 (untagged) - Human hippocalcin like 4 (HPCAL4), transcript variant 2



  "NM_001282396" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
HPCAL4 mouse monoclonal antibody, clone OTI3F11 (formerly 3F11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HLP4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001282396, the custom clone sequence may differ by one or more nucleotides


ATGGGGAAGACCAACAGCAAGCTGGCCCCCGAGGTGCTGGAGGACCTTGTTCAGAACACTGAGTTCAGCG
AGCAGGAGCTGAAGCAGTGGTACAAGGGCTTCCTGAAGGACTGCCCCAGCGGCATCCTCAACCTGGAGGA
GTTTCAGCAGCTCTACATCAAGTTCTTCCCCTACGGCGACGCCTCCAAGTTCGCGCAGCACGCTTTCCGC
ACCTTCGACAAGAACGGCGACGGCACCATCGACTTCCGGGAGTTCATCTGCGCCCTGTCGGTCACCTCCC
GCGGCAGCTTCGAGCAGAAGCTCAACTGGGCCTTTGAGATGTACGACCTGGACGGCGACGGGCGCATCAC
GCGCCTGGAGATGCTGGAGATCATCGAGGCAATCTACAAGATGGTGGGCACCGTGATCATGATGCGCATG
AACCAGGACGGGCTCACGCCCCAGCAGCGTGTGGACAAGATCTTCAAGAAGATGGACCAGGATAAGGACG
ACCAGATTACATTGGAGGAGTTCAAGGAGGCAGCCAAGAGTGACCCATCCATTGTGTTGCTGCTGCAGTG
TGACATGCAGAAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001282396
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282396.1, NP_001269325.1
RefSeq Size 4776 bp
RefSeq ORF 576 bp
Locus ID 51440
UniProt ID Q9UM19
Gene Summary The protein encoded by this gene is highly similar to human hippocalcin protein and hippocalcin like-1 protein. It also has similarity to rat neural visinin-like Ca2+-binding protein-type 1 and 2 proteins. This encoded protein may be involved in the calcium-dependent regulation of rhodopsin phosphorylation. The transcript of this gene has multiple polyadenylation sites. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (2) has an additional exon in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...