SEC13L1 (SEC13) (NM_001278946) Human Untagged Clone

CAT#: SC334366

SEC13 (untagged) - Human SEC13 homolog (S. cerevisiae) (SEC13), transcript variant 5



  "NM_001278946" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to SEC13L1 (SEC13 homolog (S. cerevisiae))
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms D3S1231E; npp-20; SEC13L1; SEC13R
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278946, the custom clone sequence may differ by one or more nucleotides


ATGGTGTCAGTAATTAACACTGTGGATACCTCCCATGAGGACATGATTCACGACGCCCAGATGGACTACT
ATGGCACCCGCCTGGCAACCTGCTCATCAGACAGGTCCGTCAAAATCTTTGATGTGCGCAATGGAGGGCA
GATCCTTATCGCCGACCTCAGGGGTCATGAGGGTCCTGTGTGGCAAGTGGCCTGGGCTCACCCCATGTAC
GGCAACATCCTGGCATCGTGCTCCTATGACCGGAAAGTCATTATCTGGAGAGAGGAAAACGGCACCTGGG
AGAAGAGCCACGAGCATGCGGGACACGACTCCTCAGTGAACTCGGTGTGCTGGGCCCCCCATGACTACGG
CCTGATCCTGGCCTGTGGGAGCTCGGATGGGGCCATCTCCCTGCTGACTTACACCGGGGAAGGCCAATGG
GAAGTAAAGAAGATCAACAACGCTCACACCGTGAGTCCATCCCCTGCCTTTCGTGCAGTGAGAGCGCCTG
CCTTGCCCCGTGTCTGCTGCAGCCTCCCTAGAGGGTGGCACGGGAGGGTCCCCGCTGGACAGTGGGCCGG
GGAGTGGTCAGCTGACCAGACATGA


Restriction Sites SgfI-MluI     
ACCN NM_001278946
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278946.1, NP_001265875.1
RefSeq Size 985 bp
RefSeq ORF 585 bp
Locus ID 6396
Gene Summary The protein encoded by this gene belongs to the SEC13 family of WD-repeat proteins. It is a constituent of the endoplasmic reticulum and the nuclear pore complex. It has similarity to the yeast SEC13 protein, which is required for vesicle biogenesis from endoplasmic reticulum during the transport of proteins. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (5) differs in both UTRs and the 5' and 3' coding regions, compared to variant 3. It encodes isoform 5 which is shorter and has distinct N- and C-termini, compared to isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...