IPP 2 (PPP1R2) (NM_001291504) Human Untagged Clone
CAT#: SC334456
PPP1R2 (untagged) - Human protein phosphatase 1, regulatory (inhibitor) subunit 2 (PPP1R2), transcript variant 1
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IPP-2; IPP2; PPP1R2A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001291504, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCCTCGACGGCCTCGCACCGGCCCATCAAGGGGATCTTGAAGAACAAGACCTCTACGACTTCCT CTATGGTGGCGTCGGCCGAACAGCCCCGCGGGAATGTCGACGAGGAGCTGAGCAAAAAATCCCAGAAGTG GGATGAAATGAACATCTTGGCGACGTATCATCCAGCAGACAAAGACTATGGTTTAATGAAAATAGATGAA CCAAGCACTCCTTACCATAGTATGATGGGGGATGATGAAGATGCCTGTAGTGACACCGAGGCCACTGAAG CCATGGCGCCAGACATCTTAGCCAGGAAATTAGCTGCAGCTGAAGGCTTGGAGCCAAAGTATCGGATTCA GGAACAAGAAAGCAGTGGAGAGGAGGATAGTGACCTCTCACCTGAAGAACGAGGTAAAAAAAAGCGACAA TTTGAAATGAAAAGGAAGCTTCACTACAATGAAGGACTCAATATCAAACTAGCCAGACAATTAATTTCAA AAGACCTACATGATGATGATGAAGATGAAGAAATGTTAGAGACTGCAGATGGAGAAAGCATGAATACGGA AGAATCAAATCAAGGATCTACTCCAAGTGACCAACAGCAAAACAAATTACGAAGTTCATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291504 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291504.1, NP_001278433.1 |
RefSeq Size | 3471 bp |
RefSeq ORF | 621 bp |
Locus ID | 5504 |
Protein Families | Druggable Genome |
Gene Summary | Protein phosphatase-1 (PP1) is one of the main eukaryotic serine/threonine phosphatases. The protein encoded by this gene binds to the catalytic subunit of PP1, strongly inhibiting its activity. Ten related pseudogenes have been found throughout the human genome. Several splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236562 | PPP1R2 (myc-DDK-tagged) - Human protein phosphatase 1, regulatory (inhibitor) subunit 2 (PPP1R2), transcript variant 1 |
CNY 3,990.00 |
|
RG236562 | PPP1R2 (tGFP-tagged) - Human protein phosphatase 1, regulatory (inhibitor) subunit 2 (PPP1R2), transcript variant 1 |
CNY 4,370.00 |