NUBP2 (NM_001284502) Human Untagged Clone

CAT#: SC334584

NUBP2 (untagged) - Human nucleotide binding protein 2 (NUBP2), transcript variant 3



  "NM_001284502" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


NUBP2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CFD1; CIAO6; NBP 2; NUBP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001284502, the custom clone sequence may differ by one or more nucleotides


ATGGCCACCATAGAAGCCCTGCGTCCCTACCAGCCCCTGGGGGCCCTCGTGGTCACCACGCCCCAGGCGG
TGTCCGTGGGGGACGTGAGGCGCGAGCTGACCTTCTGTAGGAAGACGGGCTTGCGGGTGATGGGAATCGT
GGAGAATATGAGCGGCTTCACCTGCCCACACTGCACGGGGCGGCGGAGAGGAGCTGGCCCAGCTCGCCGG
GGTGCCCTTCTTAGGCTCCGTGCCCCTGGACCCTGCGCTCATGAGGACCCTGGAGGAGGGCCACGACTTC
ATCCAGGAGTTCCCTGGGAGCCCCGCCTTCGCTGCACTCACCTCCATAGCCCAGAAGATTCTGGACGCGA
CGCCCGCGTGCCTCCCCTGACTAAGGCCACCTTGCAGCCGCTTTCCAGGGCCACCAAGGGCTCTGCTCCA
GCCTCTCAGAGAAACAGAGGCCTGGGCTCGGTTCCCGGGCCCTGCAGGGGCAGGCCCAGGCAGCGTCAGC
CGGAGAGCTTCTCCCCGACCAGCCCAGCCCCAGGATGTGTCGCACCAGCAGCTCTGCCTGGTTGGCCTGC
AGTGCCGTGGTCTGCGTGCTCTGCAGCTGTGAGACGGGGGCGGCCTGGGCTCTCTTCCCATCCATGTTGC
CTACCTGTGCCCCTGGCAGCCGCGTGTCCACACAGTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001284502
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001284502.1, NP_001271431.1
RefSeq Size 1186 bp
RefSeq ORF 669 bp
Locus ID 10101
Gene Summary This gene encodes an adenosine triphosphate (ATP) and metal-binding protein that is required for the assembly of cyotosolic iron-sulfur proteins. The encoded protein functions in a heterotetramer with nucleotide-binding protein 1 (NUBP1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
Transcript Variant: This variant (3) contains multiple differences in the coding region, compared to variant 1. The encoded isoform (3) has a distinct C-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...