ARL6IP4 (NM_001278380) Human Untagged Clone

CAT#: SC334613

ARL6IP4 (untagged) - Human ADP-ribosylation factor-like 6 interacting protein 4 (ARL6IP4), transcript variant 7



  "NM_001278380" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-ARL6IP4 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SFRS20; SR-25; SRp25; SRrp37
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278380, the custom clone sequence may differ by one or more nucleotides


ATGGCTCACGTCGGCTCCCGCAAGCGCTCGAGGAGTCGCAGCCGGTCCCGGGGACGGGGGTCGGAAAAGA
GAAAGAAGAAGAGCAGGAAAGACACCTCGAGGAACTGCTCGGCCTCCACATCCCAAGCCTCACCTTCTCC
CTGCATCACAGAGAGAAGCAAGCAGAAGGCCCGGAGGAGAACAAGATCCAGCTCCTCCTCCTCTTCTTCC
AGTTCTTCTAGCTCCTCTTCTTCCTCCTCGTCCTCCTCCTCTTCCTCCAGTGATGGCCGGAAGAAGCGGG
GGAAGTACAAGGACAAGAGGAGGAAGAAGAAGAAGAAGAGGAAGAAGCTGAAGAAGAAGGGCAAGGAGAA
GGCGGAAGCACAGCAGGTGGAGGCTCTGCCGGGCCCCTCGCTGGACCAGTGGCACCGATCAGCTGGGGAG
GAAGAGGATGGCCCAGTCCTGACGGATGAGCAGAAGTCCCGAATCCAGGCCATGAAGCCCATGACCAAGG
AGGAGTGGGATGCCCGGCAGAGCATCATCCGCAAGGTGGTGGACCCTGAGACGGGGCGCACCAGGCTTAT
TAAGGGAGATGGCGAGGTCCTAGAGGAAATCGTAACCAAAGAACGACACAGAGAGATCAACAAGCAAGCC
ACCCGAGGGGACTGCCTGGCCTTCCAGATGCGAGCTGGGTTGCTTCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001278380
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278380.1, NP_001265309.1
RefSeq Size 1766 bp
RefSeq ORF 681 bp
Locus ID 51329
UniProt ID Q66PJ3
Gene Summary Involved in modulating alternative pre-mRNA splicing with either 5' distal site activation or preferential use of 3' proximal site. In case of infection by Herpes simplex virus (HSVI), may act as a splicing inhibitor of HSVI pre-mRNA.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (7) has two alternate splice sites, one of which results in a downstream start codon, compared to variant 1. The resulting isoform (7) has a shorter N-terminus and lacks an internal segment, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...