Tropomyosin 3 (TPM3) (NM_001278190) Human Untagged Clone

CAT#: SC334616

TPM3 (untagged) - Human tropomyosin 3 (TPM3), transcript variant 8



  "NM_001278190" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TPM3 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 2,700.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAPM1; CFTD; HEL-189; HEL-S-82p; hscp30; NEM1; OK/SW-cl.5; TM-5; TM3; TM5; TM30; TM30nm; TPM3nu; TPMsk3; TRK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278190, the custom clone sequence may differ by one or more nucleotides


ATGGCTGGGATCACCACCATCGAGGCGGTGAAGCGCAAGATCCAGGTTCTGCAGCAGCAGGCAGATGATG
CAGAGGAGCGAGCTGAGCGCCTCCAGCGAGAAGTTGAGGGAGAAAGGCGGGCCCGGGAACAGGCTGAGGC
TGAGGTGGCCTCCTTGAACCGTAGGATCCAGCTGGTTGAAGAAGAGCTGGACCGTGCTCAGGAGCGCCTG
GCCACTGCCCTGCAAAAGCTGGAAGAAGCTGAAAAAGCTGCTGATGAGAGTGAGAGAGGTATGAAGGTTA
TTGAAAACCGGGCCTTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAACTCAAAGAAGCTAAGCA
CATTGCAGAAGAGGCAGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATCATTGAAGGAGACTTG
GAACGCACAGAGGAACGAGCTGAGCTGGCAGAGTCCCGTTGCCGAGAGATGGATGAGCAGATTAGACTGA
TGGACCAGAACCTGAAGTGTCTGAGTGCTGCTGAAGAAAAGGCAGAGACCCGTGCTGAGTTTGCTGAGAG
ATCGGTAGCCAAGCTGGAAAAGACAATTGATGACCTGGAAGATAAACTGAAATGCACCAAAGAGGAGCAC
CTCTGTACACAAAGGATGCTGGACCAGACCCTGCTTGACCTGAATGAGATGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001278190
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278190.1, NP_001265119.1
RefSeq Size 3149 bp
RefSeq ORF 684 bp
Locus ID 7170
Protein Pathways Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), Pathways in cancer, Thyroid cancer
Gene Summary This gene encodes a member of the tropomyosin family of actin-binding proteins. Tropomyosins are dimers of coiled-coil proteins that provide stability to actin filaments and regulate access of other actin-binding proteins. Mutations in this gene result in autosomal dominant nemaline myopathy and other muscle disorders. This locus is involved in translocations with other loci, including anaplastic lymphoma receptor tyrosine kinase (ALK) and neurotrophic tyrosine kinase receptor type 1 (NTRK1), which result in the formation of fusion proteins that act as oncogenes. There are numerous pseudogenes for this gene on different chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Transcript Variant: This variant (8) lacks an alternate exon in the central coding region, but maintains the reading frame, compared to variant Tpm3.1. The encoded isoform (8) is shorter than isoform Tpm3.1cy. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...