Glutathione S Transferase theta 2 (GSTT2) (NM_001302670) Human Untagged Clone
CAT#: SC334638
GSTT2 (untagged) - Human glutathione S-transferase theta 2 (GSTT2), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
GSTT2 (Glutathione S Transferase theta 2) mouse monoclonal antibody, clone OTI3B6 (formerly 3B6)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001302670, the custom clone sequence may differ by one or more nucleotides
ATGGGCCTAGAGCTGTTTCTTGACCTGGTGTCCCAGCCCAGCCGCGCCGTCTACATCTTCGCCAAGAAGA ATGGCATCCCCTTAGAGCTGCGCACCGTGGATTTGGTCAAAGGGCAGCACAAGAGCAAGGAGTTCTTGCA GATCAACAGCCTGGGGAAACTGCCGACGCTCAAGGATGGTGATTTCATCTTGACCGAAAGCTCGGCCATC CTGATTTACCTGAGCTGTAAGTACCAGACGCCGGACCACTGGTATCCATCTGACCTGCAGGCTCGTGCCC GTGTTCATGAGTACCTGGGCTGGCATGCCGACTGCATCCGTGGCACCTTTGGTATACCCCTGTGGGTCCA GGTGTTGGGGCCACTCATTGGGGTCCAGGTGCCCAAGGAGAAGGTGGAACGCAACAGGACTGCCATGGAC CAGGCCCTGCAATGGCTGGAGGACAAGTTCCTGGGGGACAGGCCCTTCCTCGCTGGCCAGCAGCCGGTGG CTCTCGGCTATGAACTGTTTGAGGGACGGCCACGACTGGCAGCATGGCGTGGACGAGTGGAGGCTTTCCT GGGTGCTGAGCTATGCCAGGAGGCCCACAGCATCATCTTGAGCATCCTGGAACAGGCGGCCAAGAAAACC CTCCCAACACCCTCACCAGAGGCCTATCAGGCTATGCTGCTTCGAATCGCCAGGATCCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001302670 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001302670.1, NP_001289599.1 |
RefSeq Size | 1189 bp |
RefSeq ORF | 693 bp |
Locus ID | 2953 |
Protein Pathways | Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450 |
Gene Summary | The protein encoded by this gene, glutathione S-transferase (GST) theta 2 (GSTT2), is a member of a superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds. Human GSTs can be divided into five main classes: alpha, mu, pi, theta, and zeta. The theta class includes GSTT1, GSTT2, and GSTT2B. GSTT2 and GSTT2B are nearly identical to each other, and share 55% amino acid identity with GSTT1. All three genes may play a role in human carcinogenesis. The GSTT2 gene is a pseudogene in some populations. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a. This variant represents the ALT_REF_LOCI_1 alternate haplotype in the GRCh38 reference genome assembly. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...