CYB5R2 (NM_001302827) Human Untagged Clone

CAT#: SC334645

CYB5R2 (untagged) - Human cytochrome b5 reductase 2 (CYB5R2), transcript variant 3



  "NM_001302827" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
CYB5R2 mouse monoclonal antibody, clone OTI4B9 (formerly 4B9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B5R.2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001302827, the custom clone sequence may differ by one or more nucleotides


ATGAACTCCAGGAGGAGAGAGCCAATCACCTTACAGGACCCTGAAGCCAAGTACCCGCTGCCCTTGATTG
AGAAAGAGAAAATCAGCCACAACACCCGGAGGTTCCGCTTTGGACTGCCTTCGCCGGACCATGTCTTAGG
GCTTCCTGTAGGTAACTATGTCCAGCTCTTGGCAAAAATCGATAATGAATTGGTGGTCAGGGCTTACACC
CCTGTCTCCAGTGATGATGACAGAGGCTTTGTGGACCTAATTATAAAGATCTACTTCAAAAATGTACACC
CCCAATATCCTGAAGGTGGGAAGATGACTCAGTATTTGGAGAACATGAAAATCGGGGAGACCATCTTTTT
TCGAGGGCCAAGGGGACGCTTGTTTTACCATGGGCCAGGGAATCTTGGAATCAGACCAGACCAGACGAGT
GAGCCTAAAAAAACACTGGCCGATCACCTGGGAATGATTGCTGGGGGCACAGGCATCACACCCATGTTGC
AGCTCATTCGCCACATCACCAAGGACCCCAGTGACAGGACCAGGATGTCCCTCATCTTTGCCAACCAGAG
GAGGATATCTTGGTCAGAAAAGAGCTTGAAGAAATTGCCAGGACTCACCCAGACCAGTTCAACCTGTGGT
ACACCCTGGACAGGCCTCCCATTGGCTGGAAGTACAGCTCAGGCTTCGTTACTGCCGACATGA


Restriction Sites SgfI-MluI     
ACCN NM_001302827
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302827.1, NP_001289756.1
RefSeq Size 1183 bp
RefSeq ORF 693 bp
Locus ID 51700
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene belongs to the flavoprotein pyridine nucleotide cytochrome reductase family of proteins. Cytochrome b-type NAD(P)H oxidoreductases are implicated in many processes including cholesterol biosynthesis, fatty acid desaturation and elongation, and respiratory burst in neutrophils and macrophages. Cytochrome b5 reductases have soluble and membrane-bound forms that are the product of alternative splicing. In animal cells, the membrane-bound form binds to the endoplasmic reticulum, where it is a member of a fatty acid desaturation complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (3) differs in its 5' UTR and uses an alternate splice site in the 3' coding region, which results in a frameshift compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...