TRMT1 (TRMU) (NM_001282784) Human Untagged Clone
CAT#: SC334697
TRMU (untagged) - Human tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase (TRMU), transcript variant 6
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LCAL3; MTO2; MTU1; TRMT; TRMT1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282784, the custom clone sequence may differ by one or more nucleotides
ATGCCATTGCCACAGGTCACTATGCAAGAACTTCCCTGGAAGATGAAGAAGTCTTTGAGCAGAAGCACGT TAAGAAGCCCGAAGGGCTTTTCAGAAATCGGTTTGAAGTTAGAAATGGTTTCCCAGGATGCCCTGAGGAG AACCATCTTCCCTCTGGGGGGATTAACGAAAGAGTTTGTAAAGAAAATCGCTGCTGAGAATAGACTTCAT CATGTGCTTCAGAAGAAAGAGAGCATGGGCATGTGTTTCATCGGGAAGAGGAATTTTGAACATTTCCTTC TTCAGTATCTGCAGCCTCGACCTGGTCACTTTATTTCCATAGAAGACAATAAGGTTCTGGGAACACATAA AGGTTGGTTCCTGTATACCTTGGGCCAGAGAGCAAACATAGGTGGCCTGAGAGAGCCCTGGTACGTGGTG GAGAAGGACAGCGTCAAGGGTGACGTGTTTGTGGCCCCCCGGACAGACCACCCAGCCCTGTACAGGGACC TGCTGAGGACCAGCCGCGTGCACTGGATTGCGGAGGAGCCTCCCGCAGCACTGGTCCGGGACAAGATGAT GGAGTGCCACTTCCGATTCCGCCACCAGATGGCACTAGTTTGCTGTGTTCTACAAGGGGGACGAGTGCCT GGGCAGCGGGAAGATCCTGCGGCTGGGGCCGTCTGCCTACACGCTCCAGAAGGGCCAGCGCAGAGCTGGG ATGGCCACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282784 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282784.1, NP_001269713.1 |
RefSeq Size | 1725 bp |
RefSeq ORF | 711 bp |
Locus ID | 55687 |
UniProt ID | O75648 |
Gene Summary | This nuclear gene encodes a mitochondrial tRNA-modifying enzyme. The encoded protein catalyzes the 2-thiolation of uridine on the wobble positions of tRNA(Lys), tRNA(Glu), and tRNA(Gln), resulting in the formation of 5-taurinomethyl-2-thiouridine moieties. Mutations in this gene may cause transient infantile liver failure. Polymorphisms in this gene may also influence the severity of deafness caused by mitochondrial 12S ribosomal RNA mutations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (6) contains multiple differences in the coding region, including initiation of translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (f) is shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236803 | TRMU (myc-DDK-tagged) - Human tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase (TRMU), transcript variant 6 |
CNY 3,990.00 |
|
RG236803 | TRMU (tGFP-tagged) - Human tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase (TRMU), transcript variant 6 |
CNY 4,370.00 |