MAST4 (NM_001290228) Human Untagged Clone
CAT#: SC334720
MAST4 (untagged) - Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 6
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001290228, the custom clone sequence may differ by one or more nucleotides
ATGGGGGAGAAAGTTTCGGAGGCGCCAGAGCCGGTGCCCCGCGGCTGCAGTGGCCACGGCAGCCGGACTC CAGCCTCTGCGCTGGTCGCCGCGTCCTCTCCGGGTGCTTCCTCGGCCGAGTCCTCCTCGGGCTCAGAAAC TCTGTCGGAGGAAGGGGAGCCCGGCGGCTTCTCCAGAGAGCATCAGCCGCCGCCGCCGCCGCCGTTGGGA GGCACCCTGGGCGCCCGGGCGCCCGCCGCGTGGGCTCCGGCAAGCGTGCTGCTGGAGCGCGGAGTCCTTG CGCTGCCGCCGCCGCTTCCCGGAGGAGCTGTGCCGCCCGCGCCCCGGGGCAGCAGCGCGTCCCAGGAGGA GCAGGACGAGGAGCTTGACCACATATTATCCCCTCCACCCATGCCGTTTCGGAAATGCAGCAACCCAGAT GTGGCTTCTGGCCCTGGAAAATCACTGAAGTATAAAAGACAGCTGAGTGAGGATGGAAGACAGCTAAGGC GAGGGAGCCTGGGAGGAGCCCTGACTGGGAGGTACCTTCTTCCAAACCCGGTGGCGGGACAGGCCTGGCC GGCCTCTGCAGAGACGTCCAACCTCGTGCGCATGCGCAGCCAGGCCCTGGGCCAGTCGGCGCCCTCGCTC ACCGCCAGCCTGAAGGAGCTGAGTCTCCCCAGAAGAGGAAGTTTCCCTGTGTGTCCAAATGCTGGGAGAA CATCACCCCTTGGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001290228 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001290228.1, NP_001277157.1 |
RefSeq Size | 1062 bp |
RefSeq ORF | 717 bp |
Locus ID | 375449 |
UniProt ID | O15021 |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014] Transcript Variant: This variant (6) uses a distinct 3' coding region and 3' UTR compared to variant 3. The encoded protein (isoform f) has a shorter and distinct C-terminus compared to isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236826 | MAST4 (myc-DDK-tagged) - Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 6 |
CNY 3,990.00 |
|
RG236826 | MAST4 (tGFP-tagged) - Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 6 |
CNY 4,370.00 |