CHRNA10 (NM_001303035) Human Untagged Clone
CAT#: SC334781
CHRNA10 (untagged) - Human cholinergic receptor, nicotinic, alpha 10 (neuronal) (CHRNA10), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001303035, the custom clone sequence may differ by one or more nucleotides
ATGCCGGCGCGGCGGCGCGTGCTCACCTACGGCTGCTGCTCCGAGCCCTACCCCGACGTCACCTTCACGC TGCTGCTGCGCCGCCGCGCCGCCGCCTACGTGTGCAACCTGCTGCTGCCCTGCGTGCTCATCTCGCTGCT TGCGCCGCTCGCCTTCCACCTGCCTGCCGACTCAGGCGAGAAGGTGTCGCTGGGCGTCACCGTGCTGCTG GCGCTCACCGTCTTCCAGTTGCTGCTGGCCGAGAGCATGCCACCGGCCGAGAGCGTGCCGCTCATCGGGA AGTACTACATGGCCACTATGACCATGGTCACATTCTCAACAGCACTCACCATCCTTATCATGAACCTGCA TTACTGTGGTCCCAGTGTCCGCCCAGTGCCAGCCTGGGCTAGGGCCCTCCTGCTGGGACACCTGGCACGG GGCCTGTGCGTGCGGGAAAGAGGGGAGCCCTGTGGGCAGTCCAGGCCACCTGAGTTATCTCCTAGCCCCC AGTCGCCTGAAGGAGGGGCTGGCCCCCCAGCGGGCCCTTGCCACGAGCCACGATGTCTGTGCCGCCAGGA AGCCCTACTGCACCACGTAGCCACCATTGCCAATACCTTCCGCAGCCACCGAGCTGCCCAGCGCTGCCAT GAGGACTGGAAGCGCCTGGCCCGTGTGATGGACCGCTTCTTCCTGGCCATCTTCTTCTCCATGGCCCTGG TCATGAGCCTCCTGGTGCTGGTGCAGGCCCTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001303035 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001303035.1, NP_001289964.1 |
RefSeq Size | 1957 bp |
RefSeq ORF | 735 bp |
Locus ID | 57053 |
UniProt ID | Q9GZZ6 |
Protein Families | Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane |
Gene Summary | Ionotropic receptor with a probable role in the modulation of auditory stimuli. Agonist binding may induce an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. The channel is permeable to a range of divalent cations including calcium, the influx of which may activate a potassium current which hyperpolarizes the cell membrane. In the ear, this may lead to a reduction in basilar membrane motion, altering the activity of auditory nerve fibers and reducing the range of dynamic hearing. This may protect against acoustic trauma.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses two alternate splice sites at an internal exon compared to variant 1. These differences result in translation initiation at a downstream in-frame start site through ribosomal re-initiation or leaky scanning. The encoded isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236887 | CHRNA10 (myc-DDK-tagged) - Human cholinergic receptor, nicotinic, alpha 10 (neuronal) (CHRNA10), transcript variant 3 |
CNY 3,990.00 |
|
RG236887 | CHRNA10 (tGFP-tagged) - Human cholinergic receptor, nicotinic, alpha 10 (neuronal) (CHRNA10), transcript variant 3 |
CNY 4,370.00 |
其它CHRNA10产品