ATP6V0B (NM_001294333) Human Untagged Clone
CAT#: SC334898
ATP6V0B (untagged) - Human ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b (ATP6V0B), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ATP6F; HATPL; VMA16 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001294333, the custom clone sequence may differ by one or more nucleotides
ATGACGGGGCTAGCACTGCTCTACTCCGGGGTCTTCGTGGCCTTCTGGGCCTGCGCGCTGGCCGTGGGAG TCTGCTACACCATTTTTGATTTGGGCTTCCGCTTTGATGTGGCATGGTTCCTGACGGAGACTTCGCCCTT CATGTGGTCCAACCTGGGCATTGGCCTAGCTATCTCCCTGTCTGTGGTTGGGGCAGCCTGGGGCATCTAT ATTACCGGCTCCTCCATCATTGGTGGAGGAGTGAAGGCCCCCAGGATCAAGACCAAGAACCTGGTCAGCA TCATCTTCTGTGAGGCTGTGGCCATCTACGGCATCATCATGGCAATTGTCATTAGCAACATGGCTGAGCC TTTCAGTGCCACAGACCCCAAGGCCATCGGCCATCGGAACTACCATGCAGGCTACTCCATGTTTGGGGCT GGCCTCACCGTAGGCCTGTCTAACCTCTTCTGTGGAGTCTGCGTGGGCATCGTGGGCAGTGGGGCTGCCC TGGCCGATGCTCAGAACCCCAGCCTCTTTGTAAAGATTCTCATCGTGGAGATCTTTGGCAGCGCCATTGG CCTCTTTGGGGTCATCGTCGCAATTCTTCAGGTGATGAATCCCCTTGGGAAGCCTCTGTGTCCTTGTCCC CAACCTAGCCTTACCCTCCTTCTGGAGAAGCTGAAGTGCTCTCCTTCTCTACCTATAACTATAGATTCCC CCAAACAGCTTCCACCTCCTCATTTCCATCTTCTGGTTTTCTCCTACAGGGGCTCTCTATTTTTGTCTCT GATTTGGTGTCACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001294333 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001294333.1, NP_001281262.1 |
RefSeq Size | 2068 bp |
RefSeq ORF | 786 bp |
Locus ID | 533 |
Protein Families | Transmembrane |
Protein Pathways | Epithelial cell signaling in Helicobacter pylori infection, Lysosome, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection |
Gene Summary | This gene encodes a portion of the V0 domain of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. Activity of this enzyme is necessary for such varied processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014] Transcript Variant: This variant (3) contains an alternate segment in the 3' region, which results in a frameshift, compared to variant 1. The encoded isoform (3) has a longer and distinct C-terminus, compared to variant 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237004 | ATP6V0B (myc-DDK-tagged) - Human ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b (ATP6V0B), transcript variant 3 |
CNY 3,990.00 |
|
RG237004 | ATP6V0B (tGFP-tagged) - Human ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b (ATP6V0B), transcript variant 3 |
CNY 4,370.00 |
其它ATP6V0B产品