FAM86A (EEF2KMT) (NM_001289029) Human Untagged Clone
CAT#: SC334948
FAM86A (untagged) - Human eukaryotic elongation factor 2 lysine methyltransferase (EEF2KMT), transcript variant 3
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | eEF2-KMT; EFM3; FAM86A; SB153 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001289029, the custom clone sequence may differ by one or more nucleotides
ATGGCGCCCGAGGAGAACGCGGGGACCGAACTCTTGCTGCAGAGTTTCGAGCGCCGCTTCCTGGCGGCAC GCACACTGCGCTCCTTCCCCTGGCAGAGCTTAGAAGCAAAGTTAAGAGACTCATCAGATTCTGAGCTGCT GCGGGATATTTTGCACAAGCCCTCGGGAGGCTCGGTCACACTCTCCGAGAGCACGGCCATCATCTCCTAC GGTACCACAGGCCTGGTCACATGGGACGCCGCCCTCTACCTTGCAGAATGGGCCATCGAGAACCCGGCAG TCTTCACTAACAGGACTGTCCTAGAGCTTGGCAGTGGTGCTGGCCTCACAGGCCTGGCCATCTGCAAGAT GTGCCGCCCCCGGGCATACATCTTCAGCGACTGTCACAGCCGGGTCCTTGAGCAGCTCCGAGGGAATGTC CTTCTCAATGGCCTCTCATTAGAGGCAGACATCACTGCCAAGTTAGACAGCCCCAGGGTGACAGTGGCCC AGCTGGACTGGGACGTCGCGACGGTCCATCAGCTCTCTGCCTTCCAGCCAGATGTTGTCATTGCAGCAGA TGTGCTGTATTGCCCAGAAGCCATCATGTCGCTGGTCGGCGTCCTGCGGAGGCTGGCTGCCTGCCGGGAG CACCAGCGGGCTCCTGAGGTCTACGTGGCCTTTACCGTCCGCAACCCAGAGACGTGCCAGCTGTTCACCA CCGAGCTAGGCCGGGCCGGGATCAGATGGGAAGTGGAACCTCGTCATGAGCAGAAACTGTTTCCCTACGA AGAGCACTTGGAGATGGCAATGCTGAATCTCACCCTGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289029 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289029.1, NP_001275958.1 |
RefSeq Size | 2228 bp |
RefSeq ORF | 810 bp |
Locus ID | 196483 |
UniProt ID | Q96G04 |
Gene Summary | Catalyzes the trimethylation of eukaryotic elongation factor 2 (EEF2) on 'Lys-525'.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks two alternate exons in the coding region compared to variant 1. The resulting protein (isoform 3) is shorter but has the same N- and C-termini compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237054 | FAM86A (myc-DDK-tagged) - Human eukaryotic elongation factor 2 lysine methyltransferase (EEF2KMT), transcript variant 3 |
CNY 3,990.00 |
|
RG237054 | FAM86A (tGFP-tagged) - Human eukaryotic elongation factor 2 lysine methyltransferase (EEF2KMT), transcript variant 3 |
CNY 4,370.00 |
其它EEF2KMT产品