ARA9 (AIP) (NM_001302959) Human Untagged Clone

CAT#: SC334958

AIP (untagged) - Human aryl hydrocarbon receptor interacting protein (AIP), transcript variant 2



  "NM_001302959" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
AIP (ARA9) mouse monoclonal antibody, clone OTI1B6 (formerly 1B6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARA9; FKBP16; FKBP37; PITA1; SMTPHN; XAP-2; XAP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001302959, the custom clone sequence may differ by one or more nucleotides


ATGGAGCTCATCATTGGCAAGAAGTTCAAGCTGCCTGTGTGGGAGACCATCGTGTGCACCATGCGAGAAG
GGGAGATTGCCCAGTTCCTCTGTGACATCAAGCATGTGGTCCTGTACCCGCTGGTGGCCAAGAGTCTCCG
CAACATCGCGGTGGGCAAGGACCCCCTGGAGGGCCAGCGGCACTGCTGCGGTGTTGCACAGATGCGTGAA
CACAGCTCCCTGGGCCATGCTGACCTGGACGCCCTGCAGCAGAACCCCCAGCCCCTCATCTTCCACATGG
AGATGCTGAAGGTGGAGAGCCCTGGCACGTACCAGCAGGACCCATGGGCCATGACAGACGAAGAGAAGGC
AAAGGCAGTGCCACTTATCCACCAGGAGGGCAACCGGTTGTACCGCGAGGGGCATGTGAAGGAGGCTGCT
GCCAAGTACTACGATGCCATTGCCTGCCTCAAGAACCTGCAGATGAAGGAACAGCCTGGGTCCCCTGAAT
GGATCCAGCTGGACCAGCAGATCACGCCGCTGCTGCTCAACTACTGCCAGTGCAAGCTGGTGGTCGAGGA
GTACTACGAGGTGCTGGACCACTGCTCTTCCATCCTCAACAAGTACGACGACAACGTCAAGGCCTACTTC
AAGCGGGGCAAGGCCCACGCGGCCGTGTGGAATGCCCAGGAGGCCCAGGCTGACTTTGCCAAAGTGCTGG
AGCTGGACCCAGCCCTGGCGCCTGTGGTGAGCCGAGAGCTGCGGGCCCTGGAGGCACGGATCCGGCAGAA
GGACGAAGAGGACAAAGCCCGGTTCCGGGGGATCTTCTCCCATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001302959
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302959.1, NP_001289888.1
RefSeq Size 1221 bp
RefSeq ORF 816 bp
Locus ID 9049
UniProt ID O00170
Protein Families Druggable Genome, Transcription Factors
Gene Summary The protein encoded by this gene is a receptor for aryl hydrocarbons and a ligand-activated transcription factor. The encoded protein is found in the cytoplasm as part of a multiprotein complex, but upon binding of ligand is transported to the nucleus. This protein can regulate the expression of many xenobiotic metabolizing enzymes. Also, the encoded protein can bind specifically to and inhibit the activity of hepatitis B virus. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (2) contains an alternate exon in place of the first exon in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...