TSGA2 (RSPH1) (NM_001286506) Human Untagged Clone

CAT#: SC334962

RSPH1 (untagged) - Human radial spoke head 1 homolog (Chlamydomonas) (RSPH1), transcript variant 2



  "NM_001286506" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RSPH1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT79; RSP44; RSPH10A; TSA2; TSGA2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286506, the custom clone sequence may differ by one or more nucleotides


ATGTCGGACCTGGGCTCGGAGGAGTTGGAGGAGGAGGGAGAGAATGATATTGGGGGGATCTACAAATTTA
AAAATGGTGCTCGATATATCGGAGAATATGTTAGAAATAAAAAGCACGGTCAAGGCACTTTTATATATCC
AGATGGATCCAGATATGAAGGAGAGTGGGCAAATGACCTGCGGCACGGCCATGGCGTATACTACTACATC
AATAATGACACCTACACTGGAGAGTGGTTTGCTCATCAAAGGCATGGGCAAGGCACCTATTTATACGCGG
AGACGGGCAGTAAGTATGTTGGCACCTGGGTGAACGGACAGCAGGAGGGCACGGCCGAGCTCATTCACCT
GAACCACAGGTACCAGGGCAAGTTCTTGAACAAAAATCCTGTTGGCCCTGGAAAGTATGTATTTGATGTT
GGGTGTGAACAACATGGTGAATATCGTTTAACAGATATGGAAAGAGGAGAAGAGGAAGAGGAGGAAGAAT
TAGTAACTGTTGTTCCAAAATGGAAAGCTACCCAAATCACTGAATTGGCCCTGTGGACACCAACTCTCCC
CAAAAAGCCGACCTCTACGGATGGACCTGGCCAAGACGCTCCAGGAGCTGAGAGTGCAGGAGAACCCGGG
GAGGAGGCCCAGGCTCTGCTGGAGGGCTTCGAGGGTGAGATGGACATGAGGCCTGGAGATGAAGATGCAG
ACGTCCTCCGGGAAGAGAGCCGGGAGTATGACCAGGAGGAGTTCCGCTATGACATGGATGAGGGAAACAT
TAATTCTGAAGAAGAAGAAACTAGACAGTCAGACCTCCAGGACTAA


Restriction Sites SgfI-MluI     
ACCN NM_001286506
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286506.1, NP_001273435.1
RefSeq Size 1331 bp
RefSeq ORF 816 bp
Locus ID 89765
UniProt ID Q8WYR4
Gene Summary This gene encodes a male meiotic metaphase chromosome-associated acidic protein. This gene is expressed in tissues with motile cilia or flagella, including the trachea, lungs, airway brushings, and testes. Mutations in this gene result in primary ciliary dyskinesia-24. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1. The resulting shorter isoform (2) lacks an internal protein segment compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...